Медицинский колледж после 9 класса в ханты мансийске: Медицинские колледжи Ханты-Мансийского автономного округа

Содержание

Колледжи и техникумы Ханты-Мансийской AO – список 2021

Нижневартовский социально-гуманитарный колледж

  • Государственный
  • С бюджетными местами
  • С общежитием
  • 10 лучших колледжей региона
  • 500 лучших колледжей России

Ср. аттестат 4.17 балла

Специальности (14) Отзывы (0)

Нижневартовский медицинский колледж

  • Государственный
  • С бюджетными местами
  • 10 лучших колледжей региона
  • 500 лучших колледжей России

Ср. аттестат 4.21 балла

Специальности (4) Отзывы (0)

Няганский технологический колледж

  • Государственный
  • С бюджетными местами
  • С общежитием
  • 10 лучших колледжей региона
  • 500 лучших колледжей России

Ср. аттестат 3.83 балла

Специальности (23) Отзывы (0)

Советский политехнический колледж

  • Государственный
  • С бюджетными местами
  • С общежитием
  • 10 лучших колледжей региона
  • 500 лучших колледжей России

Ср. аттестат 3.93 балла

Специальности (30) Отзывы (0)

Ханты-Мансийский технолого-педагогический колледж

  • Государственный
  • С бюджетными местами
  • С общежитием
  • 10 лучших колледжей региона
  • 500 лучших колледжей России

Ср. аттестат 4.11 балла

Специальности (46) Отзывы (0)

Центр искусств для одаренных детей севера

  • Государственный
  • С бюджетными местами
  • С общежитием

Ср. аттестат 4.27 балла

Специальности (7) Отзывы (1)

Белоярский политехнический колледж

  • Государственный
  • С бюджетными местами
  • С общежитием
  • 500 лучших колледжей России

Ср. аттестат 3.63 балла

Специальности (21) Отзывы (0)

Югорский политехнический колледж

  • Государственный
  • С бюджетными местами
  • С общежитием
  • 10 лучших колледжей региона
  • 500 лучших колледжей России

Ср. аттестат 3.67 балла

Специальности (31) Отзывы (0)

Сургутский политехнический колледж

  • Государственный
  • С бюджетными местами
  • С общежитием
  • 10 лучших колледжей региона
  • 500 лучших колледжей России

Ср. аттестат 4.23 балла

Специальности (34) Отзывы (0)

Когалымский политехнический колледж

  • Государственный
  • С бюджетными местами
  • 10 лучших колледжей региона
  • 500 лучших колледжей России

Ср. аттестат 4.01 балла

Специальности (19) Отзывы (0)

Колледж Югорский государственный университет — в г. Нефтеюганск

  • Государственный
  • С бюджетными местами
  • 10 лучших колледжей региона
  • 500 лучших колледжей России

Ср. аттестат 4.07 балла

Специальности (7) Отзывы (0)

Игримский политехнический колледж

  • Государственный
  • С бюджетными местами
  • С общежитием

Ср. аттестат 3.53 балла

Специальности (24) Отзывы (0)

Лангепасский политехнический колледж

  • Государственный
  • С бюджетными местами

Ср. аттестат 3.62 балла

Специальности (47) Отзывы (0)

Мегионский политехнический колледж

  • Государственный
  • С бюджетными местами

Ср. аттестат 3.60 балла

Специальности (35) Отзывы (0)

Нижневартовский политехнический колледж

  • Государственный
  • С бюджетными местами

Ср. аттестат 3.91 балла

Специальности (18) Отзывы (0)

Нижневартовский строительный колледж

  • Государственный
  • С бюджетными местами
  • С общежитием

Ср. аттестат 3.65 балла

Специальности (17) Отзывы (0)

Урайский политехнический колледж

  • Государственный
  • С бюджетными местами
  • С общежитием

Ср. аттестат 3.88 балла

Специальности (22) Отзывы (0)

Колледж Ханты-Мансийская государственная медицинская академия

  • Государственный
  • С бюджетными местами
  • С общежитием
  • 10 лучших колледжей региона
  • 500 лучших колледжей России

Ср. аттестат 4,14 балла

Специальности (4) Отзывы (0)

Междуреченский агропромышленный колледж

  • Государственный
  • С бюджетными местами
  • С общежитием

Ср. аттестат 3.50 балла

Специальности (21) Отзывы (0)

Радужнинский политехнический колледж

  • Государственный
  • С бюджетными местами

Ср. аттестат 3.61 балла

Специальности (23) Отзывы (0)

Нефтеюганский политехнический колледж

  • Государственный
  • С бюджетными местами
  • С общежитием

Ср. аттестат 4.15 балла

Специальности (23) Отзывы (0)

Колледж Сургутский институт экономики, управления и права

  • Негосударственный

Ср. аттестат 3.75 балла

Специальности (16) Отзывы (0)

Колледж Югорский государственный университет — в г. Сургут

  • Государственный
  • С бюджетными местами

Ср. аттестат 4.05 балла

Специальности (8) Отзывы (0)

Колледж Югорский государственный университет — в г. Нижневартовск

  • Государственный
  • С бюджетными местами

Ср. аттестат 3.93 балла

Специальности (12) Отзывы (0)

Колледж Югорский государственный университет — в г. Лянтор

  • Государственный
  • С бюджетными местами

Ср. аттестат 3.97 балла

Специальности (6) Отзывы (0)

Колледж Тюменский индустриальный университет — в г. Сургут

  • Государственный
  • С бюджетными местами

Ср. аттестат 4.06 балла

Специальности (2) Отзывы (0)

Колледж Финансовый университет при Правительстве РФ — в г. Сургут

  • Государственный
  • С бюджетными местами

Ср. аттестат 4.17 балла

Специальности (2) Отзывы (0)

Лангепасский политехнический колледж — филиал в г. Покачи

  • Государственный
  • С бюджетными местами

Ср. аттестат 3.72 балла

Специальности (21) Отзывы (0)

Златоустовский техникум технологий и экономики — филиал в г. Нижневартовск

  • Государственный
  • С бюджетными местами
Специальности (6) Отзывы (0)

Самарский энергетический колледж — филиал в г. Сургут

  • Государственный
  • С бюджетными местами
Специальности (4) Отзывы (0)

Специальности и направления

Отделение подготовки квалифицированных рабочих технологического профиля

Колледжи Ханты-Мансийской AO

МАП при Правительстве Москвы

Без экзаменов и ЕГЭ на базе 9 и 11 классов. Гос. диплом, 9 направлений, все формы обучения. Программа колледж-вуз.

Колледж при Университете

Государственный диплом. На базе 9 и 11 классов.
Все формы обучения. Без экзаменов и ЕГЭ.

  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами
  • Государственный
  • С бюджетными местами

Ханты-Мансийский технолого-педагогический колледж

  • Главное
  • Факультеты и специальности
  • Условия поступления
  • Студ Life
  • Публикации
  • Контакты
Бюджетное финансирование (бесплатное обучение):
Негосударственное финансирование (платное обучение):
Наличие общежития:
Отсрочка от службы:
Трудоустройство:
Военная кафедра:
Медицинское обслуживание:
Спортивные секции:
Команда КВН:
Кол-во студентов 1247
Кол-во преподавателей 74
Кол-во кандидатов наук 4

Общая информация

АУ «Ханты-Мансийский технолого-педагогический колледж» – одно из старейших средних специальных учебных заведений России, его история насчитывает более 82 лет.

История Ханты-Мансийского педагогического колледжа начиналась в 1930-е годы, когда был образован Остяко-Вогульский национальный округ. Ликвидация неграмотности среди туземных народностей Уральского Севера стала одной из главных задач для округа в период его становления. На основании Постановления Президиума Уральского областного исполнительного комитета от 14 февраля 1932 года № 146 «О хозяйственном и культурном строительстве в северных национальных округах Уральской области» туземное отделение Тобольского педагогического техникума и подготовительная трехгодичная туземная школа были переведены в п. Остяго-Вогульск Остяко-Вогульского национального округа. Остяко-Вогульскгий педагогический техникум стал первым средним специальным учебным заведением по подготовке педагогических кадров для национальных школ округа, позднее переименованное в Ханты-Мансийское национальное педагогическое училище (основание — Постановление Верховного Совета СССР за № 2045 9 апреля 1932 года).

В 1932 году на первый курс были переведены 8 учащихся из туземного отделения Тобольского педагогического техникума и 22 учащиеся зачислены на подготовительное отделение. Основной контингент учащихся коренной национальности был представлен территориям Самаровского, Кондинского и Микоянского районов.

Первым директором Остяко-Вогульского педагогического техникума был назначен Пестов Степан Филиппович (1932-1936 гг.), который возглавил коллектив преподавателей.

1933 г. – училище и общежитие переведены из помещения Самаровской начальной школы в новое собственное двухэтажное деревянное здание, где разместились учебные классы для двух учебных групп, общежитие для всех учащихся, столовая с кухней, актовый зал.
1935 г. – состоялся первый выпуск учителей начальных классов в количестве 8 ч.
1936 г. – приказом Наркомпроса организовано заочное отделение по подготовке учителей начальной школы, которое за время своего существования (до 1953 г.) подготовило и выпустило 185 специалистов.
1937-1941 гг. – директор Игнатов Игорь Петрович.
1941-1944 гг. – директор Бельская Инна Андреевна.
1944-1967 гг. – возглавлял училище Величко Георгий Тарасович.
1941-1945 гг. – в результате мобилизации многие из учителей, учащихся, бывших воспитанников училища, ушли на фронт.
1952 г. – начато строительство нового учебного здания, в 1959 г. завершено строительство, училище переехало в новый учебный корпус (ул. Гагарина, 3), в котором оно и находится по настоящее время.
1964 г. – начало функционировать дошкольное отделение по подготовке воспитателей дошкольных учреждений, был сделан первый выпуск в 1967 г. в количестве 50 человек.
1967-1969 гг. – директор Пашин Андрей Филиппович.
1969-1973 гг. – директор Липнягов Валентин Александрович.
1973 г. – открылось музыкальное отделение, которое сделало свой первый выпуск в 1977 году в количестве 21 человек.
1973-1980 гг. – директор Ботвинкин Николай Иванович.
1980-1981 гг. – директор Дадыко Владимир Михайлович.
1981-1987 гг. – директор Токаренко Валерий Порфирьевич.
1987-1988 гг. – директор Тюменцева Зинаида Павловна.
1988 г. – училище оборудовано кабельным телевидением, начала работу внутриучилищная студия «Гамаюн».
1988-1995 гг. – директор Макеева Альбина Михайловна.
1989 г. – начало освоение компьютерной грамотности и вычислительной техники в специально оборудованном кабинете.

В соответствии с приказом Министерства общего и профессионального образования Российской Федерации № 242 от 4 июля 1994 года и постановления Главы администрации Ханты-Мансийского автономного округа № 200 от 10 августа 1994 года Ханты-Мансийское национальное педагогическое училище преобразовано в Ханты-Мансийский педагогический колледж.

1996-1998 гг.- директор Текучев Виктор Вениаминович.
1998-2007 гг. – директор Каргаполов Евгений Павлович.
1999-2000 гг. – открыты новые специальности «Социальная педагогика», «Физическая культура», «Коррекционная педагогика в начальном образовании», «Родной язык и литература».
2002 г. – 70-летие колледжа. Закончена полная реконструкция. Снесены два деревянных корпуса – музыкального отделения и учебных мастерских. Расширены площади за счёт нового корпуса и пристроя к главному зданию.
Здание приобрело новый, унифицированный вид, заменены все коммуникации, оборудование, мебель, компьютерная техника.
2003 г. – вновь открылось заочное отделение.

На основании распоряжения Правительства Ханты-Мансийского автономного округа — Югры № 483-рп от 5 декабря 2006 года государственное образовательное учреждение среднего профессионального образования «Ханты-Мансийский педагогический колледж» признано образовательным учреждением Ханты-Мансийского автономного округа — Югры.

На основании Приказа Департамента государственной собственности Ханты-Мансийского автономного округа — Югры № 3589 от 29 октября 2007 года государственное образовательное учреждение среднего профессионального образования Ханты-Мансийского автономного округа — Югры «Ханты-Мансийский педагогический колледж» переименовано в бюджетное учреждение среднего профессионального образования Ханты-Мансийского автономного округа — Югры «Ханты-Мансийский педагогический колледж».

На основании Распоряжения Правительства Ханты-Мансийского автономного округа — Югры от 3 февраля 2009 года № 23-рп произведена реорганизация бюджетного учреждения среднего профессионального образования Ханты-Мансийского автономного округа — Югры «Ханты-Мансийский педагогический колледж» и бюджетного учреждения среднего профессионального образования Ханты-Мансийского автономного округа — Югры «Ханты-Мансийский политехнический колледж» путем присоединения Ханты-Мансийского политехнического колледжа к Ханты-Мансийскому педагогическому колледжу и переименования последнего в бюджетное учреждение среднего профессионального образования Ханты-Мансийского автономного округа — Югры «Ханты-Мансийский технолого-педагогический колледж».

Ханты-Мансийский политехнический колледж был создан на основании постановления Правительства Ханты-Мансийского автономного округа от 24 июня 2002 года №380-п на базе филиала Сибирской государственной автомобильно-дорожной академии (СибаДИ, 1998 г.). Директором филиала СибаДИ, а позднее Политехнического колледжа был назначен Матвеев Сергей Александрович. В 2008 г. его сменил Сударев Иван Николаевич, исполнявший обязанности директора до реорганизации колледжа. За период с 1998 по 2009 г. (до объединения с педагогическим колледжем) было выпущено более 500 специалистов по следующим специальностям «Техническое обслуживание и ремонт автомобильного транспорта», «строительство и эксплуатация автомобильных дорог и аэродромов», «Судовождение на внутренних водных путях и в прибрежном плавании», «Автоматизированные системы обработки информации в управлении».

На основании Распоряжения Правительства Ханты-Мансийского автономного округа — Югры от 9 февраля 2010 года №63-рп создано автономное учреждение среднего профессионального образования Ханты-Мансийского автономного округа — Югры «Ханты-Мансийский технолого-педагогический колледж» путем изменения типа существующего учреждения.

На основании Распоряжения Правительства Ханты-Мансийского автономного округа — Югры от 2 июля 2010 года № 223-рп произведена реорганизация автономного учреждение среднего профессионального образования Ханты-Мансийского автономного округа — Югры «Ханты-Мансийский технолого-педагогический колледж» и бюджетного учреждения среднего профессионального образования Ханты-Мансийского автономного округа — Югры «Ханты-Мансийский колледж сервиса и технологий» путем присоединения Ханты-Мансийского колледжа сервиса и технологий к Ханты-Мансийскому технолого-педагогическому колледжу.

Колледж Сервиса и технологий создан в 2007 году (директор Хвастунова Галина Николаевна) в результате объединения Ханты–Мансийского экономического колледжа и Ханты–Мансийского профессионального училища №1 (распоряжение Правительства автономного округа «О реорганизации образовательных учреждений начального и среднего профессионального образования Ханты-Мансийского автономного округа – Югры» №100-рп от 06.04.2007 г.). Ханты-Мансийский экономический колледж образован в 1936 г. как учебно-кооперативный комбинат Омского облпотребсоюза, директором был Киреев Иван Ануфриевич с 1935-1940 гг.

Основные этапы учебного заведения:
Январь 1941 год – учебный комбинат преобразован в торгово-кооперативную школу, директорами были с 1940-1947 гг. – Непомнящих Леонтий Матвеевич, Колесников Георгий Иванович.
1947-1954 гг. – Абросимов Николай Павлович.
1949-1957 гг. – Молоков Георгий Васильевич.
1957-1960 гг. – Тандалова Людмила Алексеевна (общие годы работы в ТКШ с 1946 по 1960)
Март 1960 год – торгово-кооперативная школа переименована в кооперативное училище, директорами были с 1960-1962 гг. – Шмидт Виталий Сергеевич.
1962-1965 гг. – Коробова Анна Алексеевна.
Март 1966 год – на базе училища открыт филиал Тюменского кооперативного техникума с дневными и заочными отделениями и УКП в г. Салехарде, директорами были с 1966-1983 гг. – Мешкова Нина Федоровна (с 1954 г. работала преподавателем).
1983-1989 гг. – Овсянникова Татьяна Николаевна.
1989-2010 гг. – Хвастунова Галина Николаевна. За эти годы тоже произошли некоторые изменения: март 1992 г. – училище и филиал техникума преобразованы в коммерческое учебное заведение ПТУ-ТЕХНИКУМ». Июнь 1995 г. – распоряжением заместителя главы администрации Ханты-Мансийского автономного округа В.Т. Бобылева «ПТУ-техникум» получил статус экономического колледжа. Декабрь 2001 г. – статус экономического колледжа считать Государственным образовательным учреждением среднего профессионального образования «Ханты-Мансийский экономический колледж».

За 75 лет существование подготовлено около 13000 специалистов более чем по 20 профессиям и специальностям («Менеджмент», «Коммерция», «Правоведение», «Гостиничный сервис», «Маркетинг» и т.д.).

Ханты-Мансийское профессиональное училище №1 образовано было в 1942 году как школа фабрично-заводского обучения №16 (Школа ФЗО №16). За 65 лет существования подготовлено около 22000 специалистов более чем по 50 профессиям.

На сегодняшний день Ханты-Мансийский технолого-педагогический колледж – многоуровневое, многопрофильное образовательное учреждение среднего профессионального образования. В 2012 году ему исполнится 80 лет. Образовательный комплекс колледжа включает в себя три учебных корпуса, специализированные лаборатории и производственные мастерские, библиотеки, актовые и спортивные залы, общежития, студенческое кафе, здравпункты, учебную станцию техобслуживания.

С 2010 года потребителями образовательных услуг колледжа является более двух тысяч человек по очной форме обучения и более восьмисот человек по заочной. Ежегодно колледж выпускает более 500 специалистов, образование которых обеспечивает коллектив преподавателей и мастеров производственного обучения в количестве около 200 человек. Педагогический коллектив включён в работу по реализации различных сетевых проектов, получающих одобрение на федеральном уровне.

Колледж гордится своими студентами, они ежегодно получают образовательные гранты губернатора автономного округа, становятся победителями в конкурсе «Лучший студент учреждений начального и среднего профессионального учреждения округа» и получают именные стипендии губернатора. Активное участие принимают студенты в конференциях, соревнованиях и конкурсах различного уровня и показывают высокие результаты.

За достигнутые результаты колледж является неоднократным лауреатом конкурса «100 лучших ссузов России» и «Лучшие колледжи Урала 2010», внесен в реестры «Лучшее образовательное учреждение России» и «Надёжная репутация» и во Всероссийский каталог добросовестных поставщиков товаров, работ, услуг для государственных и муниципальных нужд.

Понравилась статья? Поделиться с друзьями:

Adblock detector

🏛️ список заведений, на бюджетной основе

Подборка учебных заведений в Ханты-Мансийске, куда можно пойти учиться после 9 класса. Советы и рекомендации по выбору учебного заведения.

После 9 класса у ученика появляется сложный выбор:

  1. Продолжить обучение в школе переходя в 10 класс, получить полное среднее образование и только потом пойти в ВУЗ.
  2. Получить специальное профессионально образование поступив в колледж, техникум или училище и потом сразу пойти работать по специальности, либо продолжить обучение в ВУЗе.

Если вы решили после 9 класса получать профессиональное образование, то это хороший выбор.

На кого пойти учиться после 9 класса

На сегодняшний существуют сотни, если не тысячи профессий, которые можно получить с помощью техникумов, колледжей и училищ – от слесаря и маляра до бухгалтера и медицинского работника, и одной статьи не хватит, чтобы разобрать их все. Список профессий после 9 класса уточняйте у образовательного учреждения.

При выборе профессии обязательно следуйте личным предпочтениям, а не советам родственников и знакомых, тем более не поддавайтесь на уловки «за этой профессией будущее», «ты сможешь много зарабатывать», «такие специалисты всегда будут нужны».

Выбирайте будущую профессию с душой, но не импульсивно, взвешивайте каждую мелочь. И помните, что вы можете в любой момент изменить свой путь и начать изучать что-то новое.

Куда можно поступить после 9 класса с тройками

Колледжи на базе 9 классов

Адрес 1

Адрес 1

Ханты-Мансийский технолого-педагогический колледж

Адрес:

628012, Ханты-Мансийский автономный округ-Югра, г. Ханты-Мансийск, ул. Гагарина, д. 3

Телефоны:

(34671) 3-22-88, 3-44-56, 3-14-87, 3-14-74

Важно! Уточните возможность оказания услуги при личном визите или по телефону.

Список подготовлен на основе открытых данных из сети интернет, если вы обнаружили неточности в описании и/или контактых данных организации, то сообщите нам об этом, используя форму обратной связи.

Если вы захотите продолжить обучение в ВУЗе по той же специальности, на которой обучались в техникуме или училище, то у вас будет огромное преимущество перед теми, кто получил только полное общее образование:

  • во-первых, у вас уже есть багаж полезных знаний;
  • во-вторых, скорее всего у вас уже будет реальная практика (в лабораториях учебных заведений, а у многих и на реальных рабочих местах), а это многое значит при поступление в высшее учебное заведение.

Профессии будущего

В связи с бешеной скоростью развития технологий появляется огромное количество различных профессий, до которых государственные учебные заведения в Ханты-Мансийском автономном округе доберутся ещё не скоро, но специалисты в этих развивающихся областях нужны уже сегодня.

Здесь вам помогут различные узкопрофильные курсы, которых огромное количество. Мы можем порекомендовать для жителей г.Ханты-Мансийск следующие обучающие онлайн платформы:

  • https://netology.ru – огромное количество курсов по маркетингу, программированию, машинному обучению, бизнесу, управлению и т.п. Помогают с дальнейшим трудоустройством в крупные компании
  • https://geekbrains.ru, https://ru.hexlet.io и https://htmlacademy.ru – самые популярные сервисы для изучения программирования на русском языке
  • https://www.cybermarketing.ru и http://www.topexpert.pro – обучение интернет-маркетингу, SMM, SEO и веб-аналитики
  • http://welcome.stepik.org/ru, https://openedu.ru – хорошие образовательные платформы с онлайн-курсами по различным тематикам
  • https://4brain.ru – развитие памяти, скорочтения, критического мышления, финансового управления и многое другое
  • https://postnauka.ru – отличные лекции от специалистов в различных областях. Один из самых лучших сервисов для открытия новых знаний
  • https://www.intuit.ru – старый проект, содержит в себе огромное количество лекций и курсов

Мегионский политехнический колледж

14.10.2021 Вниманию родителей обучающихся колледжа!
В 2021 году образовательными организациями высшего образования Российской Федерации реализуются мероприятия в рамках федерального проекта «Современная школа» национального проекта «Образование» государственной программы Российской Федерации «Развитие образования». Вашему вниманию предлагается следующая информация

05.10.2021 Информация об организации учебного процесса в колледже
В период с 05.10.2021 г. по 29.10.2021 г. учебный процесс в колледже будет организован в формате смешанного обучения

15.09.2021 Содействие занятости

В рамках федерального проекта «Содействие занятости» в 2021 году БУ «Мегионский политехнический колледж» реализует программы профессионального обучения (профессиональная подготовка, переподготовка) по профессии 16675 «Повар».

08.09.2021 Правонарушениям – нет!
В колледже проведена профилактическая работа по недопущению правонарушений

03.09.2021 ВМЕСТЕ ПРОТИВ ТЕРРОРА
Материалы информационной акции «Мир детям», посвященной памятной дате «День солидарности в борьбе с терроризмом»
Материалы доступны по ссылке
https://cloud.mail.ru/public/xPqh/SKqoSCZya

02.09.2021 ЭТО ВАЖНО ЗНАТЬ!
Информация для родителей о последствиях токсикомании

02.09.2021 Памятка для родителей «Курительные смеси»

02.09.2021 Остерегайтесь: насвай!
Лепят его в домашних условиях – там, где находят нужное количество верблюжьего кизяка или куриного помета.

31.08.2021 День знаний — 1 сентября
Примите самые искренние поздравления с Днем знаний!

27.08.2021 Останься НЕзависимым!
Наркомания – это пустые глаза, атрофированные, бесчувственные и безнравственные души, единственным смыслом существования которых является поиск ядовитого зелья.

19.08.2021 Приказ №368 об «Организации временного трудоустройства несовершеннолетних граждан в возрасте от 14 до 18 лет в свободное от учебы время в сентябре 2021 года»

17.08.2021 Телефон доверия

09.08.2021 Умейте говорить «НЕТ!»
В колледже в течение учебного года проводится большая работа по профилактике алкоголизма в студенческой среде.

09.08.2021 ВНИМАНИЕ: СНИФФИНГ — ПОДРОСТКОВЫЙ ФЕНОМЕН

04.08.2021 Все о Медиации

04.08.2021 ВНИМАНИЕ: МЕДИАЦИЯ – ДЛЯ ВСЕХ!

03.08.2021 Памятка для подростков О ВРЕДЕ КУРЕНИЯ!

02.08.2021 Памятка Уголовная ответственность
для обучающихся БУ «Мегионский политехнический колледж» и их родителей об уголовной ответственности за преступления, предусмотренные статьями 212 (массовые беспорядки), 212.1 (неоднократное нарушение установленного порядка организации либо проведения собрания, митинга, демонстрации, шествия или пикетирования), 213 (хулиганство), 21.4 (вандализм) Уголовного кодекса РФ

02.08.2021 НЕТ НАСИЛИЮ В СЕМЬЕ

02.08.2021 Памятка «Нет насилию»

Депутат думы ХМАО потребовал признать незаконным постановление об обязательной вакцинации

https://www.znak.com/2021-10-14/deputat_dumy_hmao_potreboval_priznat_nezakonnym_postanovlenie_ob_obyazatelnoy_vakcinacii

2021.10.14

Депутат думы ХМАО Алексей Савинцев обратился в региональную прокуратуру с просьбой провести проверку законности недавнего постановления главного государственного санитарного врача по ХМАО Майи Соловьевой об обязательной вакцинации отдельных категорий населения. Парламентарий считает, что документ противоречит пунктам российского законодательства, а значит должен быть аннулирован.

«Постановление главного государственного санитарного врача по ХМАО Майи Соловьевой наделало шуму и вызвало резкий рост нескрываемой социальной злобы у жителей региона. Как выяснилось эта противозаконная повальная принудительная вакцинация еще и стартовала с нарушением закона. Как можно исполнять и оспаривать документ, который еще и не был опубликован официально? Не был опубликован, но уже попал во все пресс-релизы и новостные ленты, как, якобы свершившийся факт», — написал депутат в своем запросе, адресованном прокуратуре округа.

В региональном Роспотребнадзоре не смогли прокомментировать информацию об обращении Савинцева в прокуратуру, сославшись на то, что пока ничего об этом не знают.

Напомним, о постановлении Роспотребнадзора по ХМАО об обязательной вакцинации от коронавируса ряда категорий граждан, стало известно 9 октября. В этот день ряд региональных СМИ со ссылкой на правительство ХМАО сообщили о том, что с 11 октября все непривитые работники медицинских, образовательных организаций, организаций социального обслуживания, многофункциональных центров, работники транспорта и транспортной инфраструктуры, сотрудники правоохранительных органов, а также вахтовики обязаны пройти вакцинационный курс.

Власти ХМАО: система здравоохранения перегружена из-за роста заболеваемости коронавирусом

Также сообщалось, что лица не имеющие ни одной прививки, будут отстранены от работы с 1 ноября, а не прошедшие полный курс вакцинации — с 1 декабря.

Также напомним, сегодня директор департамента здравоохранения ХМАО Алексей Добровольский в своем в своем аккаунте в Instagram сообщил о том, что региональная медицинская сфера работает с перегрузкой, так как в течение октября в 2,5 раза увеличилось число пациентов на стационарном лечении в ковидных госпиталях. В два раза возросло и количество вызовов скорой помощи

По мнению чиновника, на ситуацию с обострением коронавируса и усложнением получения «нековидной» медицинской помощью в поликлиниках и больницах, напрямую влияет низкий уровень вакцинации среди населения.

Хочешь, чтобы в стране были независимые СМИ? Поддержи Znak.com

Тюмень | Врач Медицинского города лидирует в рейтинге образовательной активности

14 октября 2021

Татьяна Куцева, заведующий отделением анестезиологии и реанимации Медицинского города, никогда не упускает возможность поучаствовать в конференциях или образовательных программах и занимает первое место в региональном рейтинге портала НМО по специальности «Анестезиология-реаниматология».

НМО – хорошо известная медикам аббревиатура, обозначающая новую форму повышения квалификации медицинских работников. Система непрерывного медицинского образования пришла на смену курсам повышения квалификации, проводимым ранее один раз в пять лет.

Теперь любой медработник имеет возможность узнавать о новых подходах, методиках, прогрессивных системах в сфере своей специализации даже на ежедневной основе. За пройденные образовательные модули, участие в вебинарах, мастер-классах, конференциях специалист получает так называемые ЗЕТ баллы – 1 единица ЗЕТ эквивалентна 1 часу, отведённому обучению.

Татьяна Викторовна по результатам индивидуального пятилетнего цикла обучения набрала более 1300 баллов. Образовательные циклы она проходит по двум специальностям: «Анестезиология-реаниматология» (около 800 ЗЕТ баллов) и «Организация здравоохранения и общественное здоровье» (522 ЗЕТ балла). В итоговом соотношении Татьяна Викторовна в три раза превысила необходимый для прохождения обязательной аккредитации уровень, равный 250 баллам, по своей основной специальности и в два раза – по второй. В среднем Татьяна Викторовна уделяет обучению и повышению квалификации по 22 часа в месяц, или более 5 часов в неделю. По словам заведующей отделения анестезиологии и реанимации Медицинского города, стремление к самообразованию, повышению квалификации – это требование современности, неотъемлемая часть комплексной медицинской профессии.

«Анестезиология и реаниматология активно развивается. В работу вводятся новые протоколы, стандарты, появляется передовое оборудование – всё это требует специального рассмотрения и экспертного анализа. Я и мои коллеги в отделении всегда стремимся к поиску новых эффективных решений, стоящих перед нами вызовов и задач. Без непрерывного обучения, самосовершенствования врачу довольно сложно ориентироваться в современных возможностях медицины, которые ежегодно обновляются. Мы учимся, чтобы быть лучшими в профессии, но в конечном итоге мы учимся для того, чтобы оказывать нашим пациентам качественную и безопасную медицинскую помощь в соответствии с международными стандартами», – рассказала Татьяна Викторовна.

В Медицинском городе заботятся о том, чтобы врачи и медицинские сёстры регулярно повышали свой уровень профессиональных компетенций.

«НМО отличают непрерывность, использование дистанционных технологий, а также возможность выстраивания персональной траектории обучения. Это позволяет нашим специалистам получать знания, умения, навыки и компетенции, соответствующие именно их потребностям. Хочу отметить, что врачи Медицинского города весьма ответственны в вопросах обучения. Заставлять их учиться нет необходимости – они учатся сами и получают от этого удовольствие, а в медицинской профессии это очень важно», – пояснила врач-методист организационно-методического кабинета Медицинского города Надежда Маркова.

НМО, повышение профессионального уровня медицинских работников на регулярной основе, освоение ими передовых методик и технологий и приобретение навыков использования современного оборудования способствуют достижению одной из приоритетных целей национального проекта «Здравоохранение», а именно обеспечению медицинских организаций квалифицированными кадрами.

Источник: Департамент здравоохранения Тюменской области
Контакты: (3452) 427850, [email protected], [email protected]
Автор: Юлия Дёминова, пресс-служба ГАУЗ ТО «МКМЦ «Медицинский город» Фото автора
Дата создания: 15.10.2021
Дата обновления: 15.10.2021

Академического регламента | Нью-Йоркский медицинский колледж

NYMC> Высшая школа фундаментальных медицинских наук (GSBMS)> Академический регламент

Учебный регламент

Конфиденциальность записей об образовании учащихся

Политика Нью-Йоркского медицинского колледжа заключается в защите информации, содержащейся в записях студентов, от несанкционированного разглашения и во всех отношениях в соответствии с положениями Закона о правах семьи на образование и неприкосновенность частной жизни 1974 года и связанных с ним положений.

Статус регистрации

Статус студента (полный рабочий день, неполный рабочий день, неполный рабочий день, отпуск) определяется на семестровой основе для осенних и весенних семестров. Во время летней академической сессии регистрация не требуется. Студенты должны быть зачислены в программу получения степени, чтобы считаться очными. Декан GSBMS является последней инстанцией при определении статуса студента в отдельных случаях.

Статус полного рабочего дня
Чтобы иметь право на отсрочку ссуды и финансовую помощь, студенты должны либо работать полный рабочий день, либо выполнять достаточную частичную нагрузку.Только студенты очной формы обучения имеют право на получение жилья на территории кампуса, медицинского обслуживания студентов или медицинского страхования студентов. Иностранные студенты с визой F-1 должны участвовать в очной программе, чтобы сохранить свой визовый статус.

Учащийся считается полностью занятым в соответствии с условиями, изложенными в следующих разделах.

к.э.н. Студенты
Ph.D. студенты работают полный рабочий день, если они зарегистрированы на 12 кредитов или участвуют в утвержденной академической деятельности эквивалентного уровня, такой как лабораторные исследования или диссертационные исследования.

М.С. Студенты
M.S. студенты обучаются на дневном отделении при соблюдении следующих условий:

  1. при регистрации на 8 кредитов.
  2. , если зарегистрирован хотя бы один академический кредит для исследования магистерской диссертации при полной занятости в исследовательском проекте в рамках магистерской программы Plan B. Эта классификация требует, чтобы все другие программные требования были выполнены после успешного завершения учебной программы семестра. Эта классификация может использоваться не более двух семестров на одну степень.
  3. , если зарегистрирован минимум 6 кредитов, но меньше 8 из-за отсутствия курсов, соответствующих программе обучения студента. Утвержденная академическая деятельность, эквивалентная количеству пропущенных кредитов, должна быть осуществлена ​​для того, чтобы претендовать на статус полного рабочего дня в соответствии с этой классификацией.
  4. иностранный студент по студенческой визе, если он зарегистрирован на менее 8 кредитов из-за языковых трудностей. Эта классификация может применяться только в первом семестре аспирантуры.

Любой магистрант, желающий получить статус очного в соответствии с условиями, указанными в пунктах (2) — (4), должен заполнить форму подтверждения статуса очного обучения во время регистрации. Заполненная форма должна быть подписана как студентом, так и руководителем аспирантуры. Любая необходимая документация должна быть приложена к форме. Декан решает, имеет ли студент право на полный рабочий день в соответствии с положениями этой политики.

Студенты, занятые неполный рабочий день и неполный рабочий день
Студенты, которые не работают полный рабочий день, считаются зачисленными на неполный или неполный рабочий день в зависимости от количества кредитов относительно номинальной дневной нагрузки в 12 кредитов для Ph.D. программ и 8 кредитов для M.S. программы.

Не зачисленные студенты
Незачисленные студенты могут записаться максимум на 2 курса (6 кредитов) в семестр и на «пожизненный» максимум 12 кредитов. Декан имеет право отменить ограничение для студентов, не зачисленных в школу, с хорошей академической успеваемостью, если есть достаточные основания для такого отказа. Не поступающие в школу с хорошей репутацией (средний балл 3,00 или выше), желающие поступить в университет, должны подать заявку на программу по своему выбору до завершения 12 кредитов.

Непрерывное зачисление
Зачисленные студенты должны продолжать зачисление до тех пор, пока не будут выполнены все требования к получению степени. Студенты могут сохранять свой статус зачисления в течение всех осенних и весенних семестров либо (а) записавшись на один или несколько курсов, либо (б) заплатив плату за обучение в течение обычного периода регистрации. Плата за поддержание регистрации не взимается для докторантов, работающих полный рабочий день. студенты, получающие льготы по оплате за обучение. Студентам, не зачисленным в университет, не обязательно продолжать обучение.

Все студенты должны быть зарегистрированы в семестре, который они заканчивают. Если все дидактические курсы были завершены к этому семестру, студент должен зарегистрироваться для сохранения аттестата зрелости.

Студенты, не прошедшие регистрацию на один или два семестра подряд, должны быть восстановлены на работе, прежде чем продолжить обучение. Восстановление не гарантируется. Для восстановления необходимо предоставить письмо от студента с объяснением его / ее неспособности поддерживать непрерывное зачисление.Если декан принимает объяснение и академическая успеваемость и текущая успеваемость студента приемлемы, студент будет восстановлен после уплаты сбора за восстановление (100 долларов США), а также платы за обучение и сборов, соответствующих семестру восстановления. Сбор за восстановление оплачивается как магистром, так и доктором философии. студенты.

Если студент не зарегистрируется на три (или более) семестра подряд, зачисление этого студента прекращается.Чтобы такой студент возобновил получение степени, он / она должны подать заявление о реадмиссии и уплатить сбор за повторную подачу заявления (150 долларов США). Плата за повторную подачу заявки оплачивается как магистрами, так и докторами наук. студенты. Студент должен предоставить письменное заявление с объяснением перерыва в учебе и обоснованием его / ее реадмиссии. Реадмиссия не гарантируется.

Восстановление стипендии или стипендии после перерыва в непрерывном зачислении не гарантируется, несмотря на положительное решение по любому ходатайству о восстановлении или реадмиссии.

Отпуск
Студентам-выпускникам разрешается отпуск на срок до одного года с одобрения соответствующего директора выпускной программы или заведующего отделом и декана Высшей школы. Регистратору необходимо предоставить форму отпуска. Отпуск может быть запрошен в любое время в течение периода обучения студента , за исключением периода добавления / исключения первого семестра обучения студента, когда исключительные обстоятельства считают отсрочку зачисления более подходящей.Для отсрочки студент должен обратиться в приемную комиссию, чтобы спросить об отсрочке и отмене регистрации (если применимо).

Время, потраченное на утвержденный отпуск, не будет засчитываться в срок, в течение которого должна быть завершена программа на получение степени. Абитуриенты, желающие получить отпуск, должны подать заявление не позднее, чем за неделю до первого дня занятий того семестра, в течение которого они хотят начать отпуск. Если студент хочет инициировать отпуск в течение семестра, он обычно становится официальным в начале следующего семестра.Если студент должен немедленно прервать учебу в середине семестра, будут применяться обычные правила, регулирующие отказ от текущих курсов.

Если студент возвращается по истечении утвержденного отпуска, он автоматически восстанавливается. Однако, если студент не вернется до следующего семестра, ему или ей необходимо будет подать заявление о реадмиссии. Реадмиссия в программу после отсутствия более одного года не гарантируется. Восстановление стипендии после любого отпуска, за исключением утвержденных медицинских причин, не гарантируется.

Невозможно получить ученую степень во время отпуска.

Изменения в статусе зачисления
Абитуриенты с хорошей репутацией, желающие поступить на программу получения степени, абитуриенты, желающие перейти с одной магистерской или докторской степени. программу на другую, а абитуриенты, желающие перейти с магистерской программы на доктора философии. программе или наоборот следует ознакомиться с разделом «Порядок приема» в Каталоге, а затем проконсультироваться с приемной комиссией аспирантуры.

Выход из программы
В случае, если студент желает отказаться от какой-либо программы, он должен письменно уведомить об этом директора программы аспирантуры и декана. Директор программы и декан проинформируют студента о его или ее академических возможностях до того, как будет оформлен отпуск или навсегда. Форма об отсутствии или выходе из учебного заведения, в зависимости от того, что подходит, также должны быть заполнены и подписаны студентом, директором программы и деканом.

Вид на жительство и временные ограничения

Требования к проживанию
Место жительства определяется с точки зрения кредитов за курс, а не по истекшему времени. Существуют требования к месту жительства, чтобы гарантировать, что любая степень, присуждаемая Высшей школой, основана преимущественно на академической деятельности, проводимой студентом в Медицинском колледже Нью-Йорка. Для получения степени магистра требуется как минимум 24 кредита по месту жительства в аспирантуре. Для Ph.D. степень, максимум 12 дидактических кредитов могут быть переведены из других школ и применены для выполнения требований степени, независимо от общего количества дидактических кредитов, требуемых разными докторами наук. программы. Кредиты для журнальных клубов, педагогической помощи, исследовательской подготовки или диссертационного исследования не могут быть переданы, равно как не могут быть переданы кредиты за любые курсы, получившие оценку «прошел / не прошел» или «удовлетворительно / неудовлетворительно».

Перевод кредитов
Кредиты за дидактические курсы (т.e., с буквенной оценкой), сданные в других школах, могут быть переведены и засчитаны в счет требований к степени студента как в магистратуре, так и в докторантуре. программ, при соблюдении следующих положений. Такие курсы должны рассматриваться как действительный вклад в программу обучения студента. Могут быть переведены только курсы магистратуры из аккредитованных университетов или академических институтов. Кредиты, полученные за исследовательские проекты или исследовательское обучение, не могут быть переданы. Требуется минимальная оценка B для курсов по основной специальности студента или минимальная оценка C для курсов, не относящихся к основной дисциплине студента.Студент должен предоставить заполненную форму перевода кредита вместе с программой курса, названием назначенного учебника или списком литературы по курсу и другой конкретной документацией. По завершении курса официальная стенограмма должна быть отправлена ​​непосредственно в офис GSBMS из учреждения, предлагающего курс. Директор программы определяет пригодность и кредитную стоимость предлагаемых зачетных единиц для программы обучения студента. Декан разрешает перевод, если он соответствует правилам Высшей школы, изложенным здесь.Запросы на перевод кредитов за курсы, взятые во время зачисления студента в NYMC, должны быть предварительно одобрены как директором программы студента, так и деканом. Все запросы на перевод кредитов, включая необходимую подтверждающую документацию, должны подаваться не позднее, чем за неделю до периода регистрации студента на последний семестр в NYMC.

Только зачисленные студенты могут переводить кредиты. Студенты магистратуры могут передать максимум 6 кредитов на степень магистра. требования к ученой степени; Ph.Студенты D. могут передать не более 12 кредитов для получения степени доктора философии. требования к степени. Перевод кредитов может происходить только после удовлетворительного завершения 12 кредитных часов проживания в Высшей школе. Переводные кредиты, заработанные более чем за 10 лет до даты выпуска из NYMC, не могут быть использованы для выполнения требований степени GSBMS, за исключением случаев, указанных в правилах аспирантуры. Перенесенные кредиты не переносят с собой оценку и, таким образом, не вносят вклад в средний балл студента в NYMC.

Срок выполнения требований к получению степени
Требования к получению степени магистра наук должны быть выполнены в течение пяти лет после зачисления в университет. Кредиты, заработанные до поступления в зачисление, могут быть использованы для удовлетворения требований к получению степени при условии, что десятилетний лимит индивидуальных курсов (см. Ниже) не превышен.

Требования для получения степени доктора философии должны быть выполнены в указанные ниже сроки после зачисления в кандидатскую диссертацию.D. программа.

  1. семь лет, если студент поступает сразу в докторантуру. программа при зачислении в NYMC.
  2. пять лет, если студент поступает в докторантуру. программы после получения степени магистра наук по той же дисциплине в NYMC, или после выполнения всех требований к степени магистра наук, кроме магистерской диссертации или обзора литературы, или после получения не менее 29 дидактических кредитов в NYMC, которые может быть применен к Ph.D. Требования.
  3. шесть лет, если студент поступает в докторантуру. после получения не менее 16, но не более 29 дидактических кредитов в NYMC, которые могут быть поданы на соискание степени доктора философии. требования к степени, будь то студент степени магистра или студент, не зачисленный в школу.
  4. пять лет для студентов докторантуры. программа.

Если студент не выполняет требования степени в течение указанного срока, он может подать прошение о разрешении продолжить участие в программе.Такое ходатайство может быть удовлетворено с совместного согласия аспиранта студента и декана. Когда студент делает такое ходатайство о продлении срока или когда становится очевидным, что студент не сможет или вряд ли сможет выполнить требования степени в течение указанного срока, декан должен назначить специальный наблюдательный комитет для наблюдения за успеваемостью студента. . Этот комитет должен состоять как минимум из трех преподавателей-выпускников программы или факультета студента и как минимум одного преподавателя-выпускника из-за пределов программы или факультета.В случае доктора философии Студенту может быть предложено выполнение этой роли диссертационному комитету. Комитет оценит успеваемость студента и порекомендует продление или продление. Если комитет поддерживает продление, он может рекомендовать конкретные действия, которые студент должен предпринять, чтобы повысить вероятность своевременного выполнения требований степени. Рекомендация комитета будет во многом учтена деканом при принятии решения об утверждении продления срока.Любое продление срока должно рассматриваться не реже одного раза в семестр.

Для целей этого правила датой зачисления является семестр первоначальной регистрации после зачисления в программу. Базовая единица времени — семестр. Таким образом, один год равен двум семестрам. Летний семестр не учитывается как отдельный семестр при исчислении сроков.

Десятилетний лимит на курсы
Поскольку научные знания меняются очень быстро, только курсы, завершенные в течение предыдущих десяти лет, будут засчитываться в счет выполнения требований степени для любой степени.Применение этого правила может привести к тому, что студент будет иметь недостаточное количество кредитов или неадекватное представление необходимых основных курсов для представления для получения степени. Средства правовой защиты в этой ситуации включают повторение курса, замену новым курсом, охватывающим эквивалентный объем материала, или сдачу специального экзамена, чтобы подтвердить владение студентом современными знаниями в конкретной области, представленной в устаревшем курсе (ах). Устаревшие курсы, которые не повторяются, должны оставаться в официальной транскрипте студента вместе с его оценками и должны вносить вклад в средний балл, но курсы должны быть аннотированы, чтобы указать, что они не засчитываются для выполнения требований степени.Десятилетний лимит также применяется к курсам, которые были завершены в другом университете и переведены в академическую успеваемость студента в NYMC. (Правило 10-летнего обучения применяется к студентам, поступающим в весенний семестр 1994 года или позже.)

Система оценок

Система оценок и баллов качества, присваиваемых каждой оценке, следующая:

Оценка Очков качества за кредитный час
A 4.0
A- 3,7
В + 3,3
B 3,0
Б- 2,7
С + 2,3
С 2,0
C- 1,7
F (отказ) 0,0
P (Пройдено)

Кроме того, учащимся в категориях, указанных ниже, будут присвоены следующие специальные «оценки» или отметки:

Марка Описание
AUD Аудит
GNR Оценка не получена
INC Незавершенное
IP Выполняется
Вт Вывод заявки
WF Неудача при снятии средств
MT Многосторонний
NG Курс без оценок
TR Передача


Аудит курса
Студенты, которые не хотят регистрироваться для получения кредита, могут зарегистрироваться в качестве аудиторов в соответствии со следующими условиями:

  1. Официальная регистрация и оплата полной стоимости обучения;
  2. Согласие преподавателя и наставника студента или руководителя программы в случае зачисления студентов;
  3. Достаточные классные комнаты и лабораторные помещения.

Студент получит специальную оценку AUD (аудит) за этот курс. Участие ограничено для аудита; студентам не нужно сдавать экзамены или сдавать заданный материал. За прошедший аудит курс зачетные единицы не выдаются, но курс будет внесен в академическую успеваемость студента.

Неполный
Курсам, успеваемость учащегося на которых еще не была полностью оценена из-за пропущенного задания или экзамена, пропущенного по уважительной и приемлемой причине, будет присвоена оценка INC.Студент должен выполнить работу в течение одного семестра, иначе INC будет автоматически изменен на F.

Студент, который не может завершить курс по уважительным причинам (плохое состояние здоровья, серьезное изменение места работы и т. Д.), Должен подать инструктору курса официальный запрос на отсрочку завершения курсовой работы. Если причина будет сочтена уместной, студент получит оценку INC (Неполный) за курс. Когда требуемая работа будет завершена, соответствующая оценка заменит INC.INC должен быть исправлен в течение одного семестра, в противном случае будет присвоена оценка «F». Как правило, студент должен пройти значительную часть семестра (обычно две трети семестра или более), чтобы претендовать на оценку INC. Отказ от участия является подходящим действием для студента, который должен прекратить участие в курсе до его завершения. две трети семестра. Учащийся, который выбывает из класса без официального уведомления Регистратора или прекращает участие без разрешения, получит неудовлетворительную оценку (F).

Политика экзамена на макияж
Учащемуся, пропустившему выпускной экзамен по уважительной причине, разрешается сдать экзамен на макияж в течение трех недель после окончания семестра.

Изменения в статусе курса: прекращение и прекращение участия
Студенты, которые первоначально регистрируются для получения кредита на курс и запрашивают изменение статуса, будут проинформированы инструктором курса о доступных и подходящих вариантах. Все изменения для зачисленных студентов должны быть одобрены директором программы, а официальное уведомление об изменении должно быть отправлено Регистратору через портал TouroOne.

Если студент уходит до крайнего срока удаления / добавления (т. Е. До окончания периода удаления / добавления), отправив официальное уведомление в это время Регистратору, за этот курс не будет выставлена ​​оценка, и курс не будет отображаться в успеваемость студента. Период снижения / добавления длится до определенной даты, обычно через две недели после начала обычного семестра или через одну неделю после начала летнего семестра, которая указывается в академическом календаре. Студенты, выбывшие после крайнего срока исключения / добавления, но до крайнего срока отказа, получат одну из следующих оценок (W или W / F):

Снятие (W): эта оценка будет назначена учащимся, которые выбывают с проходной оценкой, до того, как будут зарегистрированы какие-либо оценки за тест или до того, как будет определено 50% итоговой оценки.

Снятие / Отказ (W / F): Учащемуся, который выбывает с неудовлетворительным средним значением после определения более чем 50% итоговой оценки, будет присвоена оценка W / F. Вес промежуточных и выпускных экзаменов и других классных заданий к итоговой оценке сильно различается от курса к курсу. Студент обязан знать политику выставления оценок на каждом курсе.

Студентам не разрешается отказываться от курсов после крайнего срока отказа, определенной даты, указанной в академическом календаре, который обычно устанавливается через 10 недель после начала обычного семестра или через 6 недель после начала летнего семестра.Отказ от участия после истечения крайнего срока будет разрешен только после подачи прямого ходатайства декану. Утверждение будет зависеть от чрезвычайных обстоятельств.

Повторные курсы
Студенты могут повторять определенные курсы, чтобы улучшить оценку, или потому, что первоначальный курс был пройден более десяти лет назад. Новый курс и новая оценка появятся в стенограмме студента и, если оценка будет буквенной, будут включены в расчет среднего балла. Исходный курс и оценка останутся в стенограмме студента, но будут снабжены аннотациями, указывающими на то, что эта оценка больше не включается в средний балл успеваемости.Студент может повторить определенный курс только один раз.

Расчет среднего балла
Кредитная единица представляет собой один час занятий в классе в неделю в течение одного семестра (15 недель) или два или более часов формальной лабораторной работы в неделю в течение одного семестра. На курсах, предлагаемых во время летних сессий, зачетная единица представляет собой эквивалентное количество аудиторных или лабораторных работ, хотя может быть запланировано больше часов в неделю на меньшее количество недель. Стоимость каждого курса указана в каталоге курсов.

Средний балл (GPA) определяется путем деления общего количества полученных учащимся баллов качества на общее количество попыток зачисления баллов.

Пример:

Оценка Кредитные часы Оценочные баллы Оценка качества
A 4 х 4,0 = 16,0
В + 3 х 3.3 = 9,9
С 3 х 2,0 = 6,0
ИТОГО 10 31,9

Средний балл этого студента составляет 3,19 (31,9 разделить на 10).

Проходные оценки («P») и оценки за переведенные кредиты не включаются в расчет GPA студента, но могут быть засчитаны для выполнения требований степени.Неудачные оценки («F») включаются в расчеты среднего балла даже для курсов, оцениваемых по принципу «прошел / не прошел». Неудачные курсы не могут быть использованы для выполнения требований степени. Повторные курсы (т.е. первоначальная попытка) исключаются из GPA. Оценки INC, W, W / F, AUD и GNR не включены в GPA.

Академическая успеваемость

Хорошая академическая успеваемость
Студенты должны постоянно поддерживать Хорошая академическая успеваемость .Хорошая академическая успеваемость состоит из двух основных компонентов — (1) средний балл (GPA), который соответствует или превышает установленный стандарт для выпускных экзаменов, и (2) своевременное выполнение требований к ученой степени. Считается, что студент, отвечающий обоим компонентам, имеет хорошую академическую успеваемость.

Учащийся сохраняет хорошую академическую успеваемость , сохраняя средний балл «В», что выражается общим средним баллом 3,00 или выше. Кроме того, для хорошей репутации в определенных программах может потребоваться средний балл 3.00 или лучше на определенных основных курсах. Для хорошей репутации также требуется проходной балл или, в некоторых программах, установленный минимальный балл (например, B– или B) по определенным отдельным основным или факультативным курсам.

Хорошая академическая успеваемость также требует от студентов своевременного выполнения требований для предполагаемой степени, а также соблюдения установленных сроков и ограничений по времени. Невыполнение требований для получения степени в указанные сроки, неспособность поддерживать непрерывную регистрацию или отказ от записи на курсы, необходимые для выпуска, или неспособность сдать докторский квалификационный экзамен, получить докторскую степень, подать предложение на диссертацию, завершить или признать удовлетворительным прогресс в диссертации или исследовании дипломной работы или своевременная подготовка обзора литературы на степень магистра, магистерской или докторской диссертации также может поставить под угрозу положение студента в программе и подвергнуть его предупреждениям, испытательному сроку или увольнению.

к.э.н. Студенты должны получить спонсора факультета для своих диссертационных исследований. Спонсор должен быть членом факультета аспирантуры с привилегиями наставника. Несвоевременное получение спонсора диссертации само по себе является основанием для увольнения.

Испытательный срок / увольнение
Неспособность поддерживать хорошую академическую успеваемость, как определено выше, является причиной отчисления из аспирантуры, если только директор программы студента не рекомендует декану поставить студента на академический испытательный срок.После утверждения деканом о прохождении стажировки декан направляет письменное уведомление студенту и директору аспирантуры кафедры. Неспособность исправить недостаток в течение одного года после письменного уведомления приведет к увольнению из аспирантуры.

В конце каждого семестра те студенты, которые не прошли курс, получили оценку «C» или ниже по основному курсу или были рекомендованы на испытательный срок из-за того, что не смогли сохранить минимально приемлемый средний балл (см. Выше), будут уведомлены. в письменной форме деканом Высшей школы о том, что они были помещены на испытательный срок.Копии этого уведомления будут отправлены директору программы аспирантуры студента. Студенты должны знать, что письменное уведомление от декана является лишь любезностью. Неспособность поддерживать хорошую академическую успеваемость автоматически ставит студента на испытательный срок или заставляет его отчислить.

Как правило, неудавшийся курс или основной курс, по которому была получена оценка «C» или ниже, следует повторить, чтобы устранить первоначальную причину испытательного срока. В тех случаях, когда студент не прошел курс, читаемый только в разные годы, между студентом, его / ее советником, директором аспирантуры и деканом должны быть приняты некоторые меры для удаления этой неудовлетворительной оценки или устранения академической неадекватности, кроме повторяя курс.Это может включать период самостоятельного изучения студентом и всестороннюю проверку усвоения студентом материала курса. В общем, назначение студента на испытательный срок до двух лет бесполезно. Прохождение аналогичного курса в другом учебном заведении может быть рекомендовано для выполнения требования, не удовлетворенного низкими показателями в рамках курса, взятого в резиденции, но не может быть использовано для удовлетворения недостаточного среднего балла.

Студент, проходящий академический стажировку, должен соблюдать минимальные стандарты Высшей школы в течение испытательного срока.Если студент неудовлетворительно успевает в течение этого периода — например, не проходит курс или получает средний балл за семестр ниже 3,00, или отказывается от курсов из-за неадекватной академической успеваемости, декан может немедленно отчислить его. Студент на испытательном сроке, который желает сменить специальность путем перевода на другой факультет и тем самым устранить академический недостаток, может сделать это только путем формального обращения в аспирантуру.

Декан проверяет успеваемость каждого студента на испытательном сроке в конце каждого семестра.Если необходимо какое-либо действие, декан должен его предпринять в это время; в противном случае декан должен подождать до конца испытательного года, прежде чем уведомить студента, консультанта студента и директора аспирантуры о том, отстранен ли студент от испытательного срока или отчислен из аспирантуры.

Дисциплинарные меры за неприемлемое поведение
Учащиеся подлежат дисциплинарным взысканиям, включая отстранение от занятий или отчисление, из-за неприемлемого поведения.Серьезное нарушение принципов честности и порядочности является основанием для дисциплинарного взыскания. Неадекватное поведение по отношению к другим членам сообщества колледжа также может служить основанием для дисциплинарных взысканий. Если такие нарушения или поведение будут доведены до сведения декана, декан проведет расследование и при необходимости предоставит обвиняемому студенту возможность опровергнуть обвинения. Когда целостность исследования или безопасность людей находятся под угрозой непосредственного риска, декан может отстранить обвиняемого студента от любой или всех академических мероприятий или привилегий на время расследования дела.

Официальные письма об увольнении направляются деканом по рекомендации или после согласования с директором студенческой программы. Студент может обжаловать решение об отчислении из Школы.

Удовлетворительная успеваемость

Цель Политики удовлетворительного академического прогресса ( SAP ) — обеспечить своевременное завершение студентами своей академической программы при достижении и поддержании по крайней мере минимальных требуемых академических стандартов.Федеральные правила требуют, чтобы все студенты соответствовали стандартам SAP в процессе получения ученой степени, чтобы претендовать на финансовую помощь в рамках федеральных программ финансовой помощи Title IV, проводимых через Медицинский колледж Нью-Йорка, как часть Туро-колледжа и университетской системы ( ТКУС).

Эта политика распространяется на всех студентов Высшей школы основных медицинских наук Нью-Йоркского медицинского колледжа. Эта политика полностью соответствует и согласуется с общесистемной политикой SAP TCUS.Эта политика и стандарты предназначены только для целей Раздела IV Федеральной финансовой помощи и не заменяют и не отменяют другие академические политики, связанные с другими государственными или федеральными программами льгот, или с GSBMS или требованиями отдельных программ. Однако изложенные здесь стандарты должны быть не менее строгими, чем другие академические политики GSBMS.

Пожалуйста, обратитесь к нашей Политике удовлетворительной академической успеваемости (SAP), чтобы получить полное объяснение этой политики.

Ниже перечислены минимальные стандарты Высшей школы для достижения удовлетворительной успеваемости.

Программа Кредиты Минимум
CGPA
Минимум
Темп
Максимум
Временной интервал
Программа ускоренного магистратуры
32 2,80 66,67% 48
Вечерний M.S. 30 2,80 66,67% 45
Профессиональная наука
Магистр
36 2.80 66,67% 54
к.э.н. 29-39 2,80 66,67% 44-59
Доктор медицины / доктор философии. 9-16 2,80 66,67% 14-24

Выпускной

Высшая школа фундаментальных медицинских наук NYMC присуждает степени три раза в год с одной официальной церемонией вручения дипломов (выпуском) в мае. По завершении всех требований к получению степени, за исключением текущих курсов, студенты подают заявление об окончании в офис регистратора до опубликованного крайнего срока (если применимо, при подаче заявления студента необходимо уплатить невозмещаемый сбор).Ученые степени присуждаются после проверки полной успеваемости студента и подтверждения выполнения всех академических требований.

Ежегодная церемония выпуска (начала) Колледжа проводится каждый май. Студенты, присутствующие на церемонии, получат свои дипломы на сцене и должны будут приобрести выпускную одежду у поставщика колледжа. Выпускники, которые не присутствуют на церемонии, могут либо забрать свой диплом, либо потребовать, чтобы офис регистратора отправил им его по почте.Дипломы не выдаются студентам с невыполненными финансовыми обязательствами перед Колледжем.

Каждый семестр Офис Регистратора рассылает всем зачисленным в настоящее время студентам уведомление о сроках и инструкциях по заполнению и подаче формы Заявления об окончании учебы. Студент обязан отправить эту форму в установленный срок. Невыполнение этого требования может привести к отсрочке выпуска.

Для получения дополнительной информации о количестве баллов, необходимых для получения M.С. и к.т.н. градусов. Обязанностью студента является знание конкретных требований для предполагаемой степени. Хотя в некоторых случаях от конкретных требований можно отказаться, такие предложения директора программы должны быть одобрены деканом и Комитетом по академическим стандартам факультета аспирантуры. Если есть какая-либо неопределенность в отношении требований к степени или предлагаемых отказов, студенту рекомендуется поднять этот вопрос с деканом. Такие вопросы следует решать с достаточным количеством времени, чтобы исправить любые проблемы — i.е., до начала последнего года обучения студента или последнего семестра обучения.

Все степени, присуждаемые Высшей школой, требуют подачи и утверждения диссертации, диссертации или обзора литературы. Рекомендации по подготовке и форматированию этих документов доступны в офисе аспирантуры и на веб-сайте GSBMS. Утвержденная окончательная версия магистерской диссертации, обзора магистерской литературы или докторской диссертации должна быть представлена ​​в офис аспирантуры до 1 апреля.

Студенты, которые выполнили требования к дипломной работе слишком поздно для выпуска в мае, должны повторно подать заявление на выпуск в следующем семестре в установленный крайний срок. Плата за выпускной экзамен не взимается во второй раз. По запросу декан напишет письмо от имени студента, в котором объяснит, что студент соответствует требованиям для получения степени и получит диплом при следующем поступлении в колледж.

студентов, получивших степень магистра наук. степень и впоследствии подать заявку на получение докторской степени.D. Степень будет взиматься отдельный выпускной взнос за каждую степень.

Отказ от правил

Высшая школа признает, что могут возникнуть чрезвычайные обстоятельства, когда соблюдение крайнего срока или постановления создаст явные и чрезмерные трудности для студента. При таких обстоятельствах запрос об отказе от правил может быть направлен в письменной форме декану аспирантуры студентом или директором аспирантуры.

Почему MBBS дешевле в нескольких странах

Почему MBBS стоит дешевле в России, Украине, Китае, Кыргызстане по сравнению с Индией? Те, кто не может поступить в недорогие государственные медицинские колледжи Индии через вступительные экзамены, такие как AIPMET, MH-CET, EAMCET, GUJCET и т. Д., Ищут свой предстоящий выбор.Буквально, MBBS в Индии в основном в частных медицинских колледжах, которыми владеют индийские государственные служащие, стоит очень дорого.

Важной причиной является пожертвование или подушная плата за поступление в частные медицинские колледжи Индии. В среднем плата за MBBS в индийских частных медицинских колледжах составляет почти рупий. 9 Лаков в год в среднем как в противовес по крайней мере рупий. 3 озера в России и Китае. Все университеты, зависящие от России и предоставляющие программы MD и MBBS в Китае, зарегистрированные Медицинским советом Индии (MCI), являются региональными, федеральными или национальными правительственными университетами во всех этих странах.

Университеты ранее спонсировались своим правительством точно так же, как индийские государственные колледжи, медицинские колледжи или университеты.

MBBS в России и Китае по этой причине обходится нам дешевле. Тем не менее, нужно быть очень осторожным, чтобы также посмотреть на оценку университета, выставленную ВОЗ, чтобы убедиться в качестве образования, доступности структуры, знании английского языка учителями в этом колледже или этом университете, размере библиотеки , соотношение студентов и преподавателей, специализация дорожной карты до PG в области медицины, годы репетиторства на региональном языке, а также на английском языке, а также по ряду других факторов, которые следуют далее — это место в гонораре, взимаемом с учеников.

Почему MBBS дешевле в немногих странах, чем в Индии

Это связано с тем, что университет с низкими оценками может стоить вам как минимум 2 Lacs, тогда как колледжи или университеты с более высокими оценками могут стоить вам не менее 4,50 Lac в год обучения плата как Пирагов Россия NRM в Москве для изучения MBBS в Китае или России.

Как правило, существуют некоторые нарушения, которые обеспечивают более качественное образование с оценками B + по более низкой цене, например, Университет Цзилинь для MBBS в Китае, в то время как университет с оценкой B +, предлагающий 5-летнюю программу, по которой индийские студенты получают только 2.90 Lacs, которые входят в десятку лучших в Китае.

MBBS в Украине и Кыргызстане Дешевле, чем в Индии?

Плата за MBBS в Украине очень разумная, если принять во внимание другие удобства….

Украина очень безопасна для всех, вне зависимости от пола. Правопорядок нормальный. Стоимость жизни в Украине довольно низкая по сравнению с Индией и другими странами. Стоимость жизни в Украине вряд ли стоит 4 100–150 долларов в месяц (7500–10 000 рупий) в месяц.

Система образования в Украине MBBS университет охвачена «Болонским соглашением», потому что ученик может продолжить обучение в Европе после высшего образования с участием аспиранта в MBBS в Европе по дешевому MBBS в Украине, поэтому MBBS из Украины можно сделать в европе.

Курс MBBS в Кыргызстане рассчитан на полные 6 лет, включая 1 год стажировки. Стоимость всего этого курса медицины составляет от 12 до 15 лакхов.

Медицинские колледжи, предлагаемые медицинскими университетами Кыргызстана, общепризнаны Медицинским советом Индии и ВОЗ и получены каждой организацией в отрасли.Кандидаты могут предпочесть медицину в Индии после завершения MBBS в Кыргызстане.

Вы можете подписаться на наш газетный киоск в Новостях Google, нажмите кнопку

ниже Подписаться

Профили экспрессии дифференциальных некодирующих РНК инвазивных и неинвазивных аденом гипофиза

Noncoding RNA Res. 2021 сен; 6 (3): 115–122.

, a, 1 , a, 1 , a, 1 , e , a, b , b, c , a a и d,

Озал Бейлерли

a Башкирский государственный медицинский университет, Уфа, Республика Башкортостан, 450008, Россия

Динар Хасанов

a Башкирский государственный медицинский университет Башкортостана, 450008, Россия

Ильгиз Гареев

a Башкирский государственный медицинский университет, Уфа, Республика Башкортостан, 450008, Россия

Эльвир Валитов

e Няганская районная больница, Няганьская районная больница, Няганьский автономный округ Тюменская область, 628181, Россия

Андрей Сохацкий

a Башкирский государственный медицинский университет, Уфа, Республика Башкортостан, 450008, Россия

b Кафедра нейрохирургии ery, Первая дочерняя больница Харбинского медицинского университета, Харбин, 150001, Китай

Chunlei Wang

b Отделение нейрохирургии, Первая дочерняя больница Харбинского медицинского университета, Харбин, 150001, Китай

c Институт Brain Science, Харбинский медицинский университет, Харбин, 150001, Китай

Валентин Павлов

a Башкирский государственный медицинский университет, Уфа, Республика Башкортостан, 450008, Россия

Гузель Хасанова

a Башкирский государственный медицинский университет, Уфа , Республика Башкортостан, 450008, Россия

Аамир Ахмад

d Университет Алабамы в Бирмингеме, AL, 35294, США

a Башкирский государственный медицинский университет, Уфа, Республика Башкортостан, 450008, Россия

08 b Отделение нейрохирургии, Первая больница Харбинского медицинского университета, Харбин, 150001, Китай

90 628 c Институт исследований мозга, Харбинский медицинский университет, Харбин, 150001, Китай

d Университет Алабамы в Бирмингеме, AL, 35294, США

e Районная больница Нягани, Нягань, Ханты-Мансийский автономный округ, Тюменская область, 628181, Россия

1 Эти авторы внесли одинаковый вклад в данную работу.

Поступила 9 мая 2021 г .; Пересмотрено 28 июня 2021 г .; Принято 2021 июня 29.

Это статья в открытом доступе под лицензией CC BY-NC-ND (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Abstract

Предпосылки

Аденома гипофиза (ПА) составляет 10–15% всех внутричерепных новообразований. Несмотря на доброкачественный характер, ПА часто инвазивно разрастается. МикроРНК (miRNAs) и длинные некодирующие РНК (lncRNAs) представляют собой класс некодирующих РНК, которые играют важную роль в инициации и прогрессировании PA.

Aim

Целью этого исследования было найти специфические профили miR-200a и антисмысловой некодирующей РНК длинной некодирующей РНК (lncRNA) в локусе INK4 (ANRIL) в PA на основе сравнительного исследования с использованием Real- время количественный анализ полимеразной цепной реакции с обратной транскрипцией (qRT-PCR) опухолевой ткани и плазмы.

Методы

Образцы плазмы и ткани ПА были получены от двух групп включенных пациентов (15 инвазивных и 15 неинвазивных ПА). Кроме того, образцы плазмы у пациентов с инвазивной ПА были собраны до и после операции.Образцы плазмы и ткани, подвергнутые анализу qRT-PCR на уровни экспрессии miR-200a и lncRNA ANRIL.

Результаты

Уровни экспрессии miR-200a и lncRNA ANRIL были увеличены в образцах тканей пациентов с инвазивной PA, чем у пациентов с неинвазивной PA. Кроме того, уровни экспрессии циркулирующих miR-200a и lncRNA ANRIL были увеличены у пациентов с инвазивным PA, чем у пациентов с неинвазивным PA в предоперационном периоде. Однако уровень экспрессии циркулирующих в плазме miR-200a и lncRNA ANRIL был снижен у пациентов с инвазивной ПА в послеоперационном периоде.Наши результаты отражают экспрессию miR-200a и lncRNA ANRIL в образцах тканей и плазмы у пациентов с инвазивной PA. Кроме того, кривая рабочих характеристик приемника (ROC) использовалась для оценки диагностической ценности этих циркулирующих miR-200a и lncRNA ANRIL.

Заключение

Экспрессия этих связанных с опухолью нкРНК повышена в PA. Следовательно, miR-200a и lncRNA ANRIL представляют собой биомаркеры для диагностики и потенциальные мишени для новых стратегий инвазивного лечения PA.

Ключевые слова: Аденома гипофиза, инвазивная, miR-200a, lncRNA ANRIL, циркулирующая, биомаркер, терапия

1. Введение

Аденомы гипофиза (PA) являются доброкачественными, обычно медленно прогрессирующими опухолями аденогипофиза и представляют собой 10–15 % всех внутричерепных опухолей, встречающихся почти у 20% населения в целом [1]. Несмотря на доброкачественный характер, ПА часто инвазивно разрастается. Инвазивные ПА агрессивны и приводят к высокой смертности, поскольку медикаментозная и лучевая терапия частично или полностью неэффективны [2].Следовательно, понимание молекулярного патогенеза инвазивной ПА и открытие новых биомаркеров и терапевтических мишеней может облегчить раннее обнаружение, прогноз и улучшить выживаемость пациентов.

На сегодняшний день идентифицированы различные классы некодирующих РНК (нкРНК) с разными мишенями и функциями, и эти молекулы можно сгруппировать в два основных класса: малые нкРНК (<200 нуклеотидов в длину), включая микроРНК (миРНК) , и длинные некодирующие РНК (днРНК) (> 200 нуклеотидов в длину) [3,4].Было доказано, что miRNA и lncRNA играют важную роль в различных биологических процессах, включая клеточный цикл, пролиферацию, дифференцировку и апоптоз клеток [3]. Эктопическая экспрессия miRNAs и lncRNAs, участвующих в онкогенезе, хорошо описана для большинства типов опухолей [5]. Был идентифицирован ряд miRNA и lncRNA, которые действуют как промоторы опухолевой прогрессии в PA, воздействуя на гены-супрессоры опухоли или вмешиваясь в пути, которые регулируют пролиферацию клеток и влияют на инвазию опухоли, ангиогенез и апоптоз [[6], [7], [6], [7], [ 8], [9], [10]].Предыдущие исследования показали, что антисмысловой ген нкРНК miR-200a и lncRNA в локусе INK4 (ANRIL) играет роль онкогена в различных опухолях. Как показано в, их аномально высокая экспрессия может наблюдаться в различных опухолевых тканях и выполняет множество функций, регулирующих рост и инвазию опухоли [[11], [12], [13], [14], [15], [16]] ».

Таблица 1

MiR-200a и днРНК ANRIL участвуют в патогенезе различных опухолей.

, 2019 [14] 902 Кроме того, во многих биологических жидкостях человеческого тела, таких как кровь, моча, слюна и спинномозговая жидкость, были обнаружены многочисленные miRNA и lncRNA, которые называются циркулирующими [17].В биожидкости человека miRNAs и lncRNAs циркулируют во внеклеточных пузырьках (EV) (апоптотические тельца, микровезикулы, экзосомы) и связаны с макромолекулярными комплексами, такими как белок или липопротеины Argonaute 2 (Ago 2) [17]. Циркулирующие миРНК и днРНК удовлетворяют основным условиям использования в качестве неинвазивных биомаркеров, которые можно многократно и неинвазивно измерять в широком спектре типов опухолей. Циркулирующие miRNA и lncRNA могут играть важную роль в диагностике и прогнозе различных заболеваний, включая PA [18,19].Наше предыдущее исследование продемонстрировало, что циркулирующие miRNAs в образцах плазмы могут служить потенциальными диагностическими биомаркерами при внутримозговых кровоизлияниях [20]. Хотя многочисленные доказательства подчеркивают значительную роль некодирующих РНК в различных опухолях человека, насколько нам известно, на сегодняшний день нет доступных исследований роли miR-200a и lncRNA ANRIL в PA. В этом исследовании мы исследовали экспрессию miR-200a и lncRNA ANRIL в инвазивных и неинвазивных PA, чтобы определить их роль в инвазии PA.Кроме того, мы обнаружили экспрессию в плазме циркулирующих miR-200 и lncRNA ANRIL, чтобы исследовать их диагностические значения.

2. Материалы и методы

2.1. Пациенты и образцы

Проанализированы пациенты (n = 30) с диагнозом ПА в период с февраля 2020 г. по июль 2020 г. в клинике Башкирского государственного медицинского университета. Диагноз ПА был подтвержден на основании данных магнитно-резонансной томографии (МРТ) и гормональной информации, клинических проявлений, а также гистопатологических анализов и иммуногистохимического окрашивания.Было зарегистрировано 15, 9 и 6 случаев адренокортикотропного гормона (АКТГ), секретирующего ПА, пролактин-секретирующего ПА и гормона роста (ГР), секретирующего ПА, соответственно. В общей сложности 15 пациентов были отнесены к группе неинвазивной опухоли гипофиза, а остальные 15 — к группе инвазивной аденомы. Инвазивные ПА были определены как III-IV степени по классификации Харди-Вильсона и III-IV степени по классификации Knosp [1,2] (A, B). Неинвазивная ПА была определена как ограничение тела опухоли в области седла без какой-либо компрессии периферических структур (C и).Мы исключили пациентов с сердечно-сосудистыми заболеваниями, иммунными заболеваниями, операциями, травмами, органной недостаточностью, другими опухолями и инфекциями в их прошлой истории болезни, поскольку эти заболевания могут влиять на уровни некодирующих РНК у наших пациентов. После операции ткань ПА хранили при -80 ° С по стандартной методике. Некоторые фрагменты каждого образца отделяли и немедленно замораживали в жидком азоте в условиях отсутствия РНКазы до полной экстракции РНК. Образцы плазмы отбирали дважды: за 3 дня до медицинской подготовки к хирургическому вмешательству для пациентов с инвазивным и неинвазивным ПА и затем через 7 дней после операции для пациентов с инвазивным ПА, обычно в день выписки из больницы.Все образцы плазмы экстрагировали из пробирок с этилендиаминтетрауксусной кислотой (ЭДТА) и центрифугировали. После первого центрифугирования в течение 10 минут при 1600 g супернатанты осторожно удаляли и переносили в новую пробирку с последующим центрифугированием снова при 16000 g в течение 10 минут для удаления остаточных клеток крови. Затем плазму хранили при -80 ° C до дальнейшей обработки. Все образцы тканей и плазмы были взяты с одобрения всех пациентов и этического комитета клиники Башкирского государственного медицинского университета.Клинические характеристики пациентов с ПА обобщены в.

(A) PA росла в направлении супраселлярной области с инвазией в третий желудочек (степень IV по классификации Харди-Вильсона). (B) PA проник в левый кавернозный синус, чтобы окружить кавернозный сегмент сонной артерии (степень IV по классификации Knosp). ПА без инвазивного (В, Г).

Таблица 2

Характеристики пациентов с ПА (n = 30).

miR-200a
Исследование Gene-Target Тип опухоли Биологическая функция Экспрессия
Li et al., 2016 [11] PTEN Колоректальный рак Способствует пролиферации, инвазии, миграции и инвазии опухолевых клеток Повышение регуляции
Zuo et al., 2018 [12] ZEB1 Рак молочной железы Способствует инвазии и миграции опухолевых клеток Повышение регуляции
Suo et al., 2018 [13]
PTEN
Рак яичников
Способствует регуляции инвазии и миграции опухолевых клеток

LncRNA ANRIL
Исследование
Gene-Target
Тип опухоли
Биологическая функция
Экспрессия
miR-144 и PBX3 Гепатоцеллюлярная карцинома Способствует пролиферации, миграции, инвазии опухолевых клеток Повышение регуляции
Deng et al., 2019 [15] NF-kB Рак желудка Подавляет апоптоз опухолевой клетки. Способствует росту опухоли и миграции опухолевых клеток Повышение регуляции
Wu et al., 2018 [16] SOX2 Карцинома носоглотки Способствует пролиферации клеток и росту опухоли Повышение регуляции
4650 4650 9080 II Классификация II 2 2 .2. Экстракция тотальной РНК и синтез комплементарной ДНК (кДНК)

Ткань PA хранили в жидком азоте сразу после сбора. Тотальную РНК экстрагировали из замороженной опухолевой ткани и 200 мкл образцов плазмы (для днРНК ANRIL) с использованием Trizol (Invitrogen, Carlsbad, CA, USA) в соответствии с инструкциями производителя. Кроме того, общую РНК плазмы (для miR-200a) выделяли из 200 мкл образцов плазмы с использованием набора miRNeasy Serum / Plasma Kit (Qiagen) в соответствии с инструкциями производителя.Чистоту и концентрацию РНК определяли с помощью Nano-Drop 2000 (Thermo Scientific) и стабильно получали отношения A260: A280 и A260: A230, близкие к 2,0. Вся выделенная общая РНК хранилась в морозильной камере -80 ° C до использования. Обратную транскрипцию экстрагированной общей РНК в кДНК выполняли с использованием набора Transcriptor First Stand cDNA Synthesis Kit (Roche).

2.3. Количественная полимеразная цепная реакция с обратной транскрипцией в реальном времени (qRT-PCR)

qRT-PCR была проведена с использованием аппарата ABI 7500 Real-Time PCR (Applied Biosystems) и FastStart Universal SYBR Green Master (Rox) (Roche) в соответствии с инструкции производителя.Объем реакции 20 мкл. U6 для miR-200a и глицеральдегид-3-фосфатдегидрогеназа (GAPDH) для lncRNA ANRIL использовали в качестве внутреннего контроля. Последовательность всех праймеров, использованных в этом исследовании, представлена ​​в. Праймеры были получены от Invitrogen. Условия термоциклирования: 95 ° C в течение 10 минут, затем 40 циклов при 95 ° C в течение 20 с, 55 ° C в течение 20 секунд и 72 ° C в течение 20 секунд. Все анализы qRT-PCR были выполнены в трех экземплярах. Значение порога цикла (CT) больше 35 считалось ниже порога обнаружения массива.

Таблица 3
Характеристики Пациенты (n = 30)
Возраст (лет)
<50 12 18152
47
Пол
Мужской 9
Женский 21
Биологическое поведение
Температура, ° С 36.5 ± 0,2
Размер опухоли (см)
<5 9
≥5 21
Классификация
15
Класс III-IV по Харди – Уилсону 15
Класс I-II Кносп 15
Класс III-IV Кносп 15000
микроРНК / LncRNA / Внутренний контроль праймера (5′-3 ‘)
микроРНК-200а RT: CATCTTACCGGACAGTGCTGGAF: TAACACTGTCTGGTAACGATGTR: ATCGTTACCAGACAGTGTTATT
LncRNA ANRIL RT: ТТТ ТТТ ТТТ ТТТ ТТТ TTTF: TGCTCTATCCGCCAATCAGGR: GGGCCTCAGTGGCACATACC
U6 RT: CGCTTCACGAATTTGCGTGTCABF: GCTTCGGCAGCACATATACTAAAATR: CGCTTCACGAATTTGCGTGTCAT
GAPDH RT: ТТТ ТТТ ТТТ ТТТ ТТТ TTTF: GTCAAGGCTGAGAACGGGAAR: AAATGAGCCCCAGCCTTCTC

2.4. Статистический анализ

Относительные уровни miR-200a и lncRNA ANRIL определяли количественно с использованием метода 2-ΔΔCq. Кривые рабочих характеристик приемника (ROC) и площадь под кривой (AUC) были использованы для оценки диагностической мощности и точности соответственно циркулирующих miR-200a и lncRNA ANRIL. При необходимости применяли t-критерий Стьюдента, ANOVA, анализ хи-квадрат или критерий Манна-Уитни. Считалось, что вероятность P <0,05 и p <0,001 указывает на статистически значимое различие.Статистический анализ проводился с помощью программного обеспечения IBM SPSS 22.0, а графики были построены с помощью Graph-PadPrism 7.0.

3. Результаты

Уровни экспрессии MiR-200a и lncRNA ANRIL в инвазивных и неинвазивных тканях PA.

Чтобы проверить профили экспрессии miR-200a и lncRNA ANRIL в опухолевой ткани пациентов с PA, мы выявили уровни экспрессии miR-200a и lncRNA ANRIL у 15 пациентов с инвазивным и 15 пациентов с неинвазивным PA с использованием qRT- ПЦР.Результаты анализа qRT-PCR показывают, что уровень экспрессии miR-200a (A) и lncRNA ANRIL (B) в опухолевой ткани пациентов с инвазивным PA был значительно выше, чем в неинвазивной ткани PA (P <0,05). , и разница была статистически значимой. Наши результаты показали, что повышенные уровни miR-200a и lncRNA ANRIL могут играть роль в инвазии PA.

Определение уровней экспрессии miR-200a и lncRNA ANRIL в инвазивных и неинвазивных тканях PA с помощью qRT-PCR.Уровень экспрессии miR-200a (A) и днРНК ANRIL (B) в опухолевой ткани пациентов с инвазивной PA был значительно выше, чем в неинвазивной ткани PA.

3.1. Экспрессия циркулирующих miR-200a и lncRNA ANRIL в инвазивных и неинвазивных PA

Как показано на фиг.3, уровень экспрессии miR-200a и lncRNA ANRIL у пациентов с инвазивной PA был значительно выше, чем у пациентов с неинвазивной PA до операция и разница была статистически значимой (P <0.001, P <0,05; А и). Однако результаты, касающиеся экспрессии miR-200a и lncRNA ANRIL в плазме от пациентов с инвазивным PA после операции, показали, что уровень экспрессии циркулирующих miR-200a и lncRNA ANRIL был значительно ниже, чем в плазме пациентов с неинвазивным PA. до операции (P <0,05, P <0,001; C и). Кроме того, результаты показали, что уровни экспрессии циркулирующих miR-200a и lncRNA ANRIL были ниже в плазме пациентов с инвазивной PA после операции по сравнению с теми же пациентами с инвазивной PA до операции (P <0.001, P <0,05; А, Б).

Уровни экспрессии циркулирующих miR-200a и lncRNA ANRIL в плазме пациентов с инвазивными и неинвазивными PA. Уровень экспрессии miR-200a (A) и днРНК ANRIL (B) у пациентов с инвазивным PA был значительно выше, чем у пациентов с неинвазивным PA до операции. Уровень экспрессии miR-200a (C) и днРНК ANRIL (D) у пациентов с инвазивной PA после операции был значительно ниже, чем у пациентов с неинвазивной PA до операции.

Анализ уровней экспрессии и кривых ROC для циркулирующих miR-200a и lncRNA ANRIL в плазме пациентов с инвазивными ПА в период до и после операции. Уровень экспрессии miR-200a (A) и днРНК ANRIL (B) у пациентов с инвазивной PA после операции был значительно ниже, чем у пациентов с инвазивной PA до операции. AUC для miR-200a и lncRNA ANRIL составляли 0,98 (C) и 0,79 (D), соответственно, предполагая, что miR-200a и lncRNA ANRIL могут различать пациентов с инвазивным PA в до и послеоперационном периоде.Примечание: AUC ≥0,75 считается диагностически значимой для биомаркера.

3.2. Диагностические значения циркулирующих miR-200a и lncRNA ANRIL для инвазивного PA

Анализ кривой ROC

был выполнен для определения диагностической чувствительности и специфичности циркулирующих miR-200a и lncRNA ANRIL в плазме до (A, B) и после операции. (C и) период. AUC для miR-200a составляла 0,89 (95% ДИ: 0,76–1,00) и 0,83 (95% ДИ: 0,66–0,98), для lncRNA ANRIL составляла 0,76 (95% ДИ: 0,57–0.93) и 0,98 (95% ДИ: 0,95–1,00), соответственно, указывая на то, что miR-200a и lncRNA ANRIL могут дифференцировать пациентов с инвазивной PA от пациентов с неинвазивной PA. Кроме того, анализ кривой ROC для miR-200a и lncRNA ANRIL выявил AUC 0,98 (95% доверительный интервал (95% ДИ) 0, 63–0, 96) и 0,79 (95% доверительный интервал (95% ДИ): 0,68). –0,83), продемонстрировали, что эти циркулирующие некодирующие РНК показали значительную точность при различении плазмы пациентов с инвазивной ПА в дооперационном периоде от послеоперационного периода (C и).

ROC-кривые для циркулирующих miR-200a и lncRNA ANRIL между инвазивным и неинвазивным PA в до- (A, B) и послеоперационном (C, D) периодах. AUC для miR-200a и lncRNA ANRIL составляли 0,89 (A), 0,76 (B), 0,83 (C) и 0,98 (D), соответственно, предполагая, что miR-200a и lncRNA ANRIL могут отличать инвазивную PA от неинвазивной PA. Примечание: AUC ≥0,75 считается диагностически значимой для биомаркера.

4. Обсуждение

Целью этого исследования было изучить характер экспрессии и корреляцию miR-200a и lncRNA ANRIL между опухолевой тканью и плазмой у пациентов с инвазивным и неинвазивным PA.Для miR-200a и lncRNA ANRIL значимые корреляции между тканевой экспрессией и уровнями в плазме наблюдались в обеих когортах. Насколько нам известно, это первое комплексное исследование уровней экспрессии miR-200a и lncRNA ANRIL у пациентов с ПА. Кроме того, наша цель была основана на проверке изменения экспрессии miR-200 b / c и транскрипта 5 (GAS5), специфичного для остановки роста lncRNA. Однако наше текущее исследование не обнаружило статистически значимой экспрессии miR-200 b / c и lncRNA GAS5 в опухолевой ткани и плазме пациентов с ПА.Многочисленные исследования показали, что члены семейства miR-200 (miR-200a, miR-200 b, miR-200c, miR-141 и miR-429) и lncRNA GAS5 играют важную роль в развитии и прогрессировании опухоли. В частности, miR-200 b и miR-200c могут регулировать пролиферацию, инвазию и миграцию опухолевых клеток путем ингибирования транскрипции нижележащих генов (включая GTPase 3 (RhoE) семейства Rho, гомеобокс, связывающийся с E-боксом цинкового пальца (ZEB). 1, E-кадгерин, IKKβ (ингибитор ядерного фактора каппа-B-киназы β) контролируют PAI-1 (ингибитор активатора плазминогена-1)) [[21], [22], [23], [24]].Между тем, днРНК GAS5 может связываться с miR-200c-3p, способствуя апоптозу клеток A549, тем самым способствуя прогрессированию синдрома острого респираторного дистресс-синдрома (ARDS) [25]. В будущем необходимы более подробные исследования, чтобы очертить основные механизмы, с помощью которых miR-200c и lncRNA GAS5 влияют на развитие и прогрессирование опухолей. Кроме того, экспрессия днРНК GAS5 может влиять на механизм устойчивости к химиотерапии [26]. Например, Long et al. подтвердил низкую экспрессию днРНК GAS5 при эпителиальном раке яичников, установил его роль, подобную гену супрессора опухолей, и обнаружил его сенсибилизирующую функцию цисплатина (DDP) при эпителиальном раке яичников.Более того, впервые авторы исследовали специфические механизмы устойчивости эпителиального рака яичников к DDP и прогрессирования опухоли за счет оси lncRNA GAS5-E2F4-PARP1-MAPK [27]. Кроме того, в недавнем исследовании Li et al. продемонстрировали, что lncRNA GAS5 может способствовать процессу EMT и каскаду инвазии-метастазирования клеток рака груди путем конкурентного связывания с miR-216b [28].

Несколько исследований показали miR-200a как онкоген, дефицит которого способствует образованию и развитию опухолей [[11], [12], [13]].Многочисленные исследования продемонстрировали потенциальную роль miR-200a при раке яичников. Например, Shi et al. продемонстрировали, что miR-200a активируется при раке яичников и значительно ассоциируется с прогрессированием пациентов с раком яичников. Сверхэкспрессия miR-200a-3p способствует пролиферации клеток рака яичников посредством нацеливания на протокадгерин 9 ( PCDH9 ) [29]. В другом исследовании Zhu et al. Предоставили доказательства того, что miR-200a активируется в значительной части прогрессирующих карцином яичников и что повышенная экспрессия miR-200a способствует прогрессированию опухоли, например, пролиферации и инвазии опухолевых клеток [30].

Матричные металлопротеиназы (ММП) играют важную роль в опухолевой инвазии, прежде всего, через деградацию внеклеточного матрикса (ЕСМ) и / или активацию пре-ростовых факторов. Недавние исследования продемонстрировали, что miR-200a участвует в регуляции MMP на посттранскрипционном уровне и в конечном итоге влияет на трансляцию и экспрессию генов MMP. Например, Ян и др. продемонстрировали, что miR-200a сверхэкспрессируется в клетках рака мочевого пузыря и способствует инвазии опухоли, по крайней мере частично, вызывая повышенную регуляцию экспрессии матриксной металлопротеиназы-2 ( MMP-2 ) [31].Используя технологию Ago-HITS-CLIP для транскриптомной идентификации прямых мишеней miRNA Bracken et al. идентифицировали ряд факторов транскрипции, некоторые из которых были ранее идентифицированы либо как мишени семейства miR-200, либо участвовали в эпителиально-мезенхимальном переходе (EMT), инвазии и прогрессировании рака, включая матриксные металлопротеиназы-2, 9, 14 ( MMP-2,9, 14 ) активность [32]. Эти данные ясно указывают на роль экспрессии miR-200a в агрессивности опухоли.В настоящем исследовании мы обнаружили, что miR-200a значительно активируется в инвазивных тканях PA. Этот результат показал, что miR-200a, возможно, участвует в патогенезе инвазивной PA и, возможно, через регуляцию определенных генов, таких как MMP и фосфатаза, и гомолог тензина, удаленный на хромосоме 10 ( PTEN ), но это требует дальнейших исследований.

Другой нкРНК, участие которой в различных типах опухолей человека было хорошо установлено в многочисленных исследованиях, — это днРНК ANRIL [33,34].В этом исследовании мы обнаружили, что экспрессия днРНК ANRIL также была значительно увеличена в инвазивных тканях PA. Соответственно, Zhao et al. представили lncRNA ANRIL в качестве онкогена и продемонстрировали, что lncRNA ANRIL высоко экспрессируется при раке щитовидной железы, а siRNA-опосредованное молчание lncRNA ANRIL в двух поровых сегментах канала 1 ( TPC1 ) и клетки SW579 ингибируют пролиферацию, инвазию и метастазирование через трансформирующий рост. фактор бета ( TGF-β ) / путь Smad [32]. Аналогичным образом, результаты другого исследования продемонстрировали, что нокдаун днРНК ANRIL ингибирует пролиферацию, миграцию, инвазию и способствует апоптозу в клетках HepG2 посредством инактивации ядерного фактора каппа B ( NF-κB ) и сигнальных путей Wnt / β-катенин . подавлением miR-191 [34].Эти результаты в совокупности предполагают, что днРНК ANRIL является типичным онкогеном.

Кроме того, мы продемонстрировали, что циркулирующие miR-200a и lncRNA ANRIL в плазме были увеличены у инвазивных пациентов с ПА перед операцией. Однако уровень экспрессии циркулирующих в плазме miR-200a и lncRNA ANRIL был снижен у пациентов с инвазивным PA после операции. Анализ кривой ROC для циркулирующих miR-200a и lncRNA ANRIL выявил AUC 0,89, 0,76, 0,83, 0,98, 0,98 и 0,79, продемонстрировал, что циркулирующие miR-200a и lncRNA ANRIL показали значительную точность в различении плазмы инвазивных пациентов с ПА перед операцией от плазма пациентов с неинвазивной ПА и тех же пациентов с инвазивной ПА после операции.Как уже было сказано ранее, miRNA и lncRNA могут активно способствовать развитию и прогрессированию опухоли, делая циркулирующие miRNA и lncRNA потенциальными неинвазивными биомаркерами для профилактики, диагностики и прогноза опухолей. Инвазивная ПА в основном диагностируется с помощью методов нейровизуализации (МРТ или компьютерная томография (КТ)) и биопсии ткани, но все они имеют ограничения [2]. Например, методы нейровизуализации могут обнаруживать только установившиеся опухоли с достаточной массой. В настоящее время подавляющее большинство хирургических вмешательств, в том числе биопсия, на гипофизе проводится через эндоскопический эндоназальный транссфеноидальный доступ в различных его модификациях.За последние десятилетия резко снизилось количество осложнений при выполнении подобных вмешательств. Однако даже при использовании самых современных технологий не всегда удается избежать как легких, так и опасных для жизни осложнений. Одно из самых опасных — интраоперационное кровотечение в ложе опухоли [35,36]. Кроме того, не всегда возможно повторное хирургическое вмешательство и взятие образцов для определения реального молекулярного профиля прогрессирования опухоли. Жидкая биопсия — это отбор в реальном времени биомаркеров из биожидкостей, таких как нкРНК [37,38].Жидкая биопсия представляется многообещающим подходом к неинвазивному выявлению, молекулярной характеристике и мониторингу прогрессирования опухолей центральной нервной системы (ЦНС) и, в частности, инвазивных ПА. Раннее обнаружение опухолей играет важную роль в снижении смертности и, в некоторых случаях, когда дело доходит до выявления предраковых состояний и заболеваемости злокачественными опухолями. В связи с этим большое значение имеет разработка новых методов скрининга, в том числе выявления молекулярных биомаркеров ранних стадий онкогенеза.В этом сценарии разумно предположить, что прогрессирование опухоли приведет к увеличению уровня экспрессии определенных онкогенных циркулирующих нкРНК, например, в кровотоке у пациентов с инвазивной ПА [37,38]. В результате циркулирующие miR-200a и lncRNA ANRIL становятся кандидатами на появление неинвазивных биомаркеров инвазивной PA.

LncRNA и miRNA являются новыми и многообещающими мишенями, которые можно превратить в биомаркеры для диагностики и прогноза, а также вариантов лечения. Недавно сообщалось о взаимодействии между lncRNAs и miRNA, а также о его патофизиологическом значении для PA.Напр., Небольшая ядрышковая РНК хозяина, ген 6 ( SNHG6 ) / ось miR-944 играет критическую роль в регуляции пролиферации, миграции, инвазии и EMT PA посредством регуляции RAB11A [39]. В другом исследовании Tang et al. показали, что AFAP1-AS1 действует как конкурирующая РНК miR-103a-3p, регулируя рост PA через сигнальный путь фосфоинозитид-3-киназы ( PI3Ks ) / RAC-альфа / серин / треонин-протеинкиназа ( AKT ) [40 ]. Текущий уровень знаний показал, что miRNA и lncRNA не только индивидуально важны в регуляции туморогенеза, но и что их перекрестная коммуникация представляет собой новый аспект патогенеза и прогрессирования опухоли.Также может иметь место непрямое взаимодействие между miR-200a и днРНК ANRIL в PA. Однако необходимы дальнейшие исследования, чтобы выяснить точное взаимодействие между miR-200a и lncRNA ANRIL в PA.

Настоящее исследование имеет ряд ограничений. Во-первых, возможные клинические последствия паттерна miR-200a и lncRNA ANRIL в ткани и плазме для обнаружения, диагностики и прогноза инвазивных пациентов с PA еще предстоит выяснить с использованием большего количества образцов пациентов. Во-вторых, мы протестировали изменение miR-200a и lncRNA ANRIL в опухолевой ткани между инвазивным и неинвазивным PA, мы не сравнивали экспрессию с нормальной тканью PA и не смогли оценить потенциальную роль этих ncRNAs в развитии неинвазивных ПА.К сожалению, в условиях пандемии Covid-19 сбор образцов был затруднен. Кроме того, стоит отметить, что существует возможная корреляция между размером опухоли, другими маркерами, такими как p53 и Ki-67, лечением, потенциальными ассоциациями между этими профилями циркулирующих нкРНК и профилями экспрессии генов и гормонами. Если результаты будут дополнительно подтверждены взаимосвязью между уровнями miR-200a и lncRNA ANRIL и уровнями белка, таких как MMP и PTEN в PA, в представленных случаях имеется трансляционный клинический потенциал.А именно, miR-200a и lncRNA ANRIL могут служить потенциальными терапевтическими мишенями для PA; однако необходимы дальнейшие исследования. Все это, несомненно, цель наших будущих исследований. Кроме того, функции и механизмы miR-200a и lncRNA ANRIL в PA требуют дальнейшего изучения.

5. Выводы

Это исследование показывает, что уровни экспрессии miR-200a и lncRNA ANRIL в опухолевой ткани и плазме пациентов с инвазивным PA были увеличены. Более того, экспрессия циркулирующих miRNA-200a и lncRNA ANRIL в плазме была снижена после операции у пациентов с инвазивной PA по сравнению с пациентами с неинвазивной PA до операции.Другими словами, повышенная экспрессия miR-200a и lncRNA ANRIL была связана с развитием и инвазией PA. Результаты этого исследования предполагают, что miR-200a и lncRNA ANRIL могут стать новой мишенью для лечения и в качестве неинвазивных биомаркеров инвазивной PA.

Финансирование

Описанное исследование финансировалось РФФИ и НФК, проект № 21-515-53017.

Согласие на участие

Письменное информированное согласие было получено от всех отдельных участников, включенных в исследование.

Этическое разрешение

Все образцы тканей и плазмы были собраны с одобрения всех пациентов и этического комитета клиники Башкирского государственного медицинского университета (2021.17.02, протокол № 17).

Заявление об авторском вкладе CRediT

Озал Бейлерли: Концептуализация, курирование данных, формальный анализ, привлечение финансирования, исследование, методология, администрирование проекта, ресурсы, программное обеспечение, надзор, проверка, визуализация, написание — первоначальный проект, написание — проверка и редактирование. Динар Хасанов: Обработка данных, формальный анализ. Ильгиз Гареев: Обработка данных, формальный анализ, исследование, методология, программное обеспечение, проверка, визуализация. Эльвир Валитов: Формальный анализ. Андрей Сохацкий: Формальный анализ. Chunlei Wang: Формальный анализ. Валентин Павлов: Формальный анализ. Гузель Хасанова: Формальный анализ. Аамир Ахмад: Концептуализация, Ресурсы, Написание — первоначальный проект, Написание — просмотр и редактирование.

Заявление о конкурирующих интересах

Авторы заявляют об отсутствии конфликта интересов.

Ссылки

1. Литгоу К., Батра Р., Мэтьюз Т., Каравитаки Н. Ведение эндокринных заболеваний: нарушение зрения у пациентов с аденомой гипофиза. Евро. J. Endocrinol. 2019; 181: R185 – R197. DOI: 10.1530 / EJE-19-0349. PMID: 31416048] [PubMed] [CrossRef] [Google Scholar] 2. Сериоли С., Доглитто Ф., Фиоринди А., Бироли А., Маттавелли Д., Буффоли Б., Феррари М., Корнали К., Роделла Л., Марольди Р., Гаспаротти Р., Николай П., Фонтанелла М.М., Полиани П.Л. Аденомы гипофиза и инвазивность с анатомо-хирургической, радиологической и гистологической точек зрения: систематический обзор литературы. Раки. 2019; 11: 1936. DOI: 10.3390 / Cancers11121936. PMID: 31817110] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Zhang X., Wang W., Zhu W., Dong J., Cheng Y., Yin Z., Shen F. Механизмы и функции длинных некодирующих РНК на нескольких регуляторных уровнях. Int. J. Mol. Sci.2019; 20: 5573. DOI: 10.3390 / ijms20225573. PMID: 31717266] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 5. Вишнубаладжи Р., Шаат Х., Эланго Р., Аладжез Н.М. Некодирующие РНК как потенциальные медиаторы устойчивости к иммунотерапии рака. Семин. Canc. Биол. 2020; 65: 65–79. DOI: 10.1016 / j.semcancer.2019.11.006. PMID: 31733291] [PubMed] [CrossRef] [Google Scholar] 6. Wu Z.R., Yan L., Liu Y.T., Cao L., Guo Y.H., Zhang Y., Yao H., Cai L., Shang H.B., Rui W.W., Yang G., Zhang X.B., Tang H., Wang Y., Хуан Дж.Й., Вэй Ю.Х., Чжао В.Г., Су Б., Ву З.Б. Ингибирование mTORC1 днРНК h29 через нарушение взаимодействия 4E-BP1 / Raptor в опухолях гипофиза. Nat. Commun. 2018; 9: 4624. DOI: 10.1038 / s41467-018-06853-3. PMID: 30397197] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 7. Fu D., Zhang Y., Cui H. Длинная некодирующая РНК CCAT2 активируется E2F1 и проявляет онкогенные свойства, взаимодействуя с PTTG1 в аденомах гипофиза. Am J Cancer Res. 2018; 8: 245–255. [PMID: 29511595] [Бесплатная статья PMC] [PubMed] [Google Scholar] 8.Zheng Z., Zhang Y., Zhang Z., Yang Y., Song T. Влияние miR-106b на инвазивность аденомы гипофиза через PTEN-PI3K / AKT. Med. Sci. Пн. Int. Med. J. Exp. Clin. Res. 2017; 23: 1277–1285. DOI: 10,12659 / msm.2. PMID: 28288092] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Renjie W., Haiqian L. MiR-132, miR-15a и miR-16 синергетически ингибируют пролиферацию, инвазию и миграцию опухолевых клеток гипофиза, воздействуя на Sox 5. Canc. Lett. 2015; 356 (2 Pt B): 568–578. DOI: 10.1016 / j.canlet.2014.10.003. PMID: 25305447] [PubMed] [CrossRef] [Google Scholar] 10. Хэ Х., Чжан Х., Ли З., Ван Р., Ли Н., Чжу Л. miRNA-214: экспрессия, терапевтический и диагностический потенциал при раке. Тумори. 2015; 101: 375–383. DOI: 10.5301 / tj.5000318. PMID: 26108246] [PubMed] [CrossRef] [Google Scholar] 11. Li Y., Sun J., Cai Y., Jiang Y., Wang X., Huang X., Yin Y., Li H. MiR-200a действует как онкоген при колоректальной карциноме, воздействуя на PTEN. Exp. Мол. Патол. 2016; 101: 308–313. DOI: 10.1016 / j.yexmp.2016.10.006. PMID: 27983967] [PubMed] [CrossRef] [Google Scholar] 12.Zou Q., Zhou E., Xu F., Zhang D., Yi W., Yao J. Регулирующая петля TP73-AS1 / miR-200a / ZEB1 способствует инвазии и миграции клеток рака груди. J. Cell. Biochem. 2018; 119: 2189–2199. DOI: 10.1002 / jcb.26380. PMID: 28857253] [PubMed] [CrossRef] [Google Scholar] 13. Suo H.B., Zhang K.C., Zhao J. MiR-200a способствует инвазии и миграции клеток карциномы яичников, воздействуя на PTEN. Евро. Rev. Med. Pharmacol. Sci. 2018; 22: 4080–4089. DOI: 10.26355 / eurrev_201807_15398. PMID: 30024595] [PubMed] [CrossRef] [Google Scholar] 14.Ma Y., Zhang H., Li G., Hu J., Liu X., Lin L. LncRNA ANRIL способствует клеточному росту, миграции и инвазии клеток гепатоцеллюлярной карциномы посредством размягчения miR-144. Anti Canc. Наркотики. 2019; 30: 1013–1021. DOI: 10.1097 / CAD.0000000000000807. PMID: 31609763] [PubMed] [CrossRef] [Google Scholar] 15. Deng W., Zhang Y., Cai J., Zhang J., Liu X., Yin J., Bai Z., Yao H., Zhang Z. LncRNA-ANRIL способствует прогрессированию рака желудка за счет усиления передачи сигналов NF-kB. Exp. Биол. Med. 2019; 244: 953–959. DOI: 10.1177 / 1535370219860207.PMID: 31242038] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16. Wu J.H., Tang J.M., Li J., Li X.W. Повышающая регуляция SOX2-активированной днРНК ANRIL способствует росту клеток карциномы носоглотки. Sci. Отчет 2018; 8: 3333. DOI: 10.1038 / s41598-018-21708-z. PMID: 29463902] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 17. Анфосси С., Бабаян А., Пантел К., Калин Г.А. Клиническая полезность циркулирующих некодирующих РНК — обновленная информация. Nat. Преподобный Clin. Онкол. 2018; 15: 541–563. DOI: 10.1038 / s41571-018-0035-х.PMID: 29784926] [PubMed] [CrossRef] [Google Scholar] 18. Немет К., Дарваси О., Лико И., Сюч Н., Цирджак С., Рейнигер Л., Сабо Б., Кроккер Л., Паллингер Э., Игаз П., Паточ А., Бутц Х. Комплексный анализ циркулирующие микроРНК в плазме крови пациентов с аденомами гипофиза. J. Clin. Эндокринол. Метаб. 2019 jc.2018-02479. [DOI: 10.1210 / jc.2018-02479. PMID: 31112271] [PubMed] [Google Scholar] 19. Wu Z.R., Yan L., Liu Y.T., Cao L., Guo Y.H., Zhang Y., Yao H., Cai L., Shang H.B., Rui W.W., Yang G., Чжан Х.Б., Тан Х., Ван Ю., Хуанг Дж.Й., Вэй Ю.Х., Чжао В.Г., Су Б., Ву З.Б. Ингибирование mTORC1 днРНК h29 через нарушение взаимодействия 4E-BP1 / Raptor в опухолях гипофиза. Nat. Commun. 2018; 9: 4624. DOI: 10.1038 / s41467-018-06853-3. PMID: 30397197] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 20. Гареев И., Ян Г., Сунь Дж., Бейлерли О., Чен Х., Чжан Д., Чжао Б., Чжан Р., Сунь З., Ян К., Ли Л., Павлов В., Сафин С. ., Чжао С. Циркулирующие микроРНК как потенциальные неинвазивные биомаркеры спонтанного внутримозгового кровоизлияния.World Neurosurg. 2020; 133: e369 – e375. DOI: 10.1016 / j.wneu.2019.09.016. PMID: 31525485. [PubMed] [CrossRef] [Google Scholar] 21. Tang Q., Li M., Chen L., Bi F., Xia H. miR-200b / c нацелен на экспрессию RhoE и подавляет пролиферацию и инвазию немелкоклеточных клеток рака легкого. Int. J. Oncol. 2018; 53 (4): 1732–1742. DOI: 10.3892 / ijo.2018.4493. [PubMed] [CrossRef] [Google Scholar] 22. Арункумар Г., Дева Магендхра Рао А.К., Маникандан М., Прасанна Шриниваса Рао Х., Суббиа С., Илангован Р., Муруган А.К., Мунираджан А.К. Нарушение регуляции микроРНК семейства miR-200 и маркеров эпителиально-мезенхимального перехода при плоскоклеточной карциноме полости рта. Oncol Lett. 2018; 15 (1): 649–657. DOI: 10.3892 / ol.2017.7296. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 23. Hurteau G.J., Carlson J.A., Roos E., Brock G.J. Стабильной экспрессии только miR-200c достаточно для регулирования TCF8 (ZEB1) и восстановления экспрессии E-кадгерина. Клеточный цикл. 2009. 8 (13): 2064–2069. DOI: 10.4161 / cc.8.13.8883. [PubMed] [CrossRef] [Google Scholar] 24.Sun Y., Yang D., Xi L., Chen Y., Fu L., Sun K., Yin J., Li X., Liu S., Qin Y., Liu M., Hou Y. Примированный атипичный проток Связанные с гиперплазией фибробласты способствуют росту клеток и изменению полярности трансформированных эпителиоподобных клеток MCF-7 рака молочной железы посредством передачи сигналов miR-200b / c-IKKbeta. Cell Death Dis. 2018; 9 (2): 122. DOI: 10.1038 / s41419-017-0133-1. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 25. Ли Х. Б., Цзы П. П., Ши Х. Дж., Гао М., Сунь К. Р. Роль сигнального пути длинного некодирующего транскрипта 5 / microRNA-200c-3p / ангиотензинпревращающего фермента 2 в апоптозе эпителиальных клеток легких человека A549 при остром респираторном дистресс-синдроме.Чжунхуа Исюэ Зажи. 2018. 98 (41): 3354–3359. DOI: 10.3760 / cma.j.issn.0376-2491.2018.41.013. [PubMed] [CrossRef] [Google Scholar] 26. Lambrou G.I., Hatziagapiou K., Zaravinos A. Некодирующая РНК GAS5 и ее роль в резистентности, индуцированной противоопухолевой терапией. Int. J. Mol. Sci. 2020; 21 (20): 7633. DOI: 10.3390 / ijms21207633. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 27. Long X., Song K., Hu H., Tian Q., Wang W., Dong Q., Yin X., Di W. Длинная некодирующая РНК GAS5 подавляет устойчивость к DDP и опухолевую прогрессию эпителиального рака яичников через GAS5 -E2F4-PARP1-MAPK ось.J. Exp. Clin. Canc. Res. 2019; 38 (1): 345. DOI: 10.1186 / s13046-019-1329-2. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 28. Ли Ю., Го Х. Б., Вэй Ю. Х. LncRNA GAS5 влияет на эпителиально-мезенхимальный переход и инвазию клеток рака груди, регулируя miR-216b. Евро. Rev. Med. Pharmacol. Sci. 2020; 24 (9): 4873–4881. DOI: 10.26355 / eurrev_202005_21176. [PubMed] [CrossRef] [Google Scholar] 29. Shi C., Yang Y., Zhang L., Yu J., Qin S., Xu H., Gao Y. MiR-200a-3p способствовал злокачественному поведению клеток рака яичников посредством регулирования PCDH9.OncoTargets Ther. 2019; 12: 8329–8338. DOI: 10.2147 / OTT.S220339. PMID: 31632082] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 30. Чжу С.Л., Гао Г.С. Сверхэкспрессия miR-200a в запущенных карциномах яичников как прогностический индикатор. Азиатский Пак. J. Cancer Prev. APJCP. 2014; 15: 8595–8601. DOI: 10.7314 / apjcp.2014.15.20.8595. PMID: 25374174] [PubMed] [CrossRef] [Google Scholar] 31. Yang R., Xu J., Hua X., Tian Z., Xie Q., Li J., Jiang G., Cohen M., Sun H., Huang C. Сверхэкспрессия miR-200a способствует инвазии рака мочевого пузыря через прямую регуляцию. Ось Dicer / miR-16 / JNK2 / MMP-2.Онкоген. 2020; 39: 1983–1996. DOI: 10.1038 / s41388-019-1120-з. PMID: 31772330] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32. Бракен С.П., Ли X., Райт Дж. А., Лоуренс Д. М., Пиллман К. А., Салманидис М., Андерсон М. А., Дредж Б. К., Грегори П. А., Цыкин А., Нилсен К., Томсон Д. В., Берт А. Г., Лерберг Дж. М., Яп А.С., Дженсен КБ, Хью-Гудолл Ю., Гудолл Г.Дж. Полногеномная идентификация мишеней miR-200 выявляет регуляторную сеть, контролирующую клеточную инвазию. EMBO J. 2014; 33: 2040–2056.DOI: 10.15252 / embj.201488641. PMID: 25069772] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Чжао Дж.Дж., Хао С., Ван Л.Л., Ху С.Ю., Чжан С., Го Л.Дж., Чжан Г., Гао Б., Цзян Ю., Тянь В.Г., Ло Д.Л. Длинная некодирующая РНК ANRIL способствует инвазии и метастазированию клеток рака щитовидной железы через сигнальный путь TGF-β / Smad. Oncotarget. 2016; 7: 57903–57918. DOI: 10.18632 / oncotarget.11087. PMID: 27507052] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Хуан Д., Би К., Чжао К., Ding X., Bian C., Wang H., Wang T., Liu H. Нокдаун длинная некодирующая РНК ANRIL ингибирует пролиферацию, миграцию и инвазию клеток HepG2 путем подавления miR-191. BMC Canc. 2018; 18: 919. DOI: 10.1186 / s12885-018-4831-6. PMID: 30249208] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 35. Dallapiazza R.F., Grober Y., Starke R.M., Laws E.R., Jr., Jane J.A., Jr. Долгосрочные результаты эндоназальной эндоскопической транссфеноидальной резекции нефункционирующих макроаденом гипофиза. Нейрохирургия.2015; 76 (1): 42–52. DOI: 10.1227 / NEU.0000000000000563. PMID: 25255271] [PubMed] [CrossRef] [Google Scholar] 36. Koutourousiou M., Gardner P.A., Fernandez-Miranda J.C., Paluzzi A., Wang E.W., Snyderman C.H. Гигантские аденомы гипофиза: преимущества и ограничения эндоскопической эндоназальной хирургии. J. Neurosurg. 2013. 118: 621–631. DOI: 10.3171 / 2012.11.JNS121190. PMID: 23289816] [PubMed] [CrossRef] [Google Scholar] 37. Бейлерли О., Гареев И., Павлов В., Чен X., Чжао С. Роль длинных некодирующих РНК в биологии аденом гипофиза.World Neurosurg. 2020; 137: 252–256. DOI: 10.1016 / j.wneu.2019.10.137. PMID: 31678448] [PubMed] [CrossRef] [Google Scholar] 38. Бейлерли О., Бирака Н.М., Гареев И., Павлов В., Ян Г., Лян Ю., Алиев Г. МиРНК как неинвазивные биомаркеры и терапевтические агенты аденом гипофиза. Int. J. Mol. Sci. 2020; 21 (19): 7287. DOI: 10.3390 / ijms21197287. PMID: 33023145] [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 39. Mao D., Jie Y., Lv Y. LncRNA SNHG6 индуцирует эпителиально-мезенхимальный переход аденомы гипофиза посредством подавления MiR-944.Рак Биотер. Радиофарм. DOI 2020: 10.1089 / cbr.2020.3587. PMID: 32935999. [PubMed] [CrossRef] [Google Scholar] 40. Tang H., Zhu D., Zhang G., Luo X., Xie W. AFAP1-AS1 способствует пролиферации клеток аденомы гипофиза через miR-103a-3p для активации сигнального пути PI3K / AKT. World Neurosurg. 2019; 130: e888 – e898. DOI: 10.1016 / j.wneu.2019.07.032. PMID: 31299308] [PubMed] [CrossRef] [Google Scholar]

Mgi nitu misis. Московский государственный горный университет

Московский государственный горный университет вошел в состав Национального исследовательского технологического университета «МИСиС».Объединенный университет получил лицензию на право ведения деятельности по всем образовательным программам МИСиС и МГГУ и свидетельство о государственной аккредитации.

В соответствии с законодательством Российской Федерации все права и обязанности Московского государственного гуманитарного университета переданы НИТУ «МИСиС». Без изменений остались: форма и вид обучения; специальность, направление обучения, специализация, профиль, названия программ, а также стоимость обучения для студентов, обучающихся на платной основе.

В контексте формирования единого вуза консолидируется весь факультет. Уже сегодня студенты объединенного университета получают доступ к развитой исследовательской и социальной инфраструктуре МИСиС и МГГУ, возможностям высокотехнологичного лабораторного комплекса и площадкам для внеклассной деятельности. Улучшатся условия проживания в общежитиях.

В ходе реорганизации произошла интеграция сильнейших научно-педагогических школ, которые будут дополнять друг друга и, опираясь на материально-техническую базу мирового уровня, будут активно развиваться.

«Конечно, работа по реорганизации далась нам нелегко. Мировая практика показывает, что объединение университетов всегда болезненно, но мы уверены, что этот процесс принесет положительные результаты.

Вместе мы должны работать в области повышения качества образования, укрепления сотрудничества с вертикально интегрированными компаниями горно-металлургического комплекса и выхода на более широкий рынок труда для выпускников, повышения их конкурентоспособности как в России, так и за рубежом », — прокомментировала ректор НИТУ «МИСиС» Алевтина Черникова.

«Выходя из одного Алма Матер — Московская горная академия — в 1918 году и имея общие исторические и академические корни, МИСиС и МГГУ развивались автономно. Сегодня на российском рынке высшего образования каждый из вузов по праву имеет лидер в своей области

Объединив наши усилия, мы получим уникальный синергетический эффект: наши образовательный и исследовательский секторы будут дополнять друг друга, что даст нам все шансы войти в сотню лучших мировых университетов и выйти в лидеры своей специализации.Сохранив все лучшее в структуре объединенного университета, МИСиС и МГГУ станут частью международного бренда », — прокомментировал и.о. ректора МГУ Вадим Петров

.

Металлургия и горнодобывающая промышленность всегда были тесно связаны. В успешных бизнесах есть сквозные вертикально интегрированные крупные компании, которые хотят продавать не промежуточный продукт: не руду, не концентраты, а металл.По мнению ведущего российского горного специалиста, председателя совета директоров и научного руководителя научно-производственной корпорации «Механобр-Техника», члена-корреспондента РАН Леонида Вайсберга, интеграция горняков, металлургов и потребителей в современные условия важна и важна. очевидный.

«От того, как работают горняки и металлурги, напрямую зависят свойства того, как будет работать карданный вал вашего автомобиля, и от этого зависит качество продукта», — отмечает эксперт.исследовательский университет », а также включен в программу 5 — 100 и в то же время готов к глубочайшей интеграции с горным институтом. Во-первых, это создаст полноценный комплекс для подготовки квалифицированных специалистов, во-вторых, МГХУ автоматически получит статус исследовательского, а также будет включен в программу повышения конкурентоспособности. Уверен, что высокопрофессиональный коллектив вуза легко адаптируется к новым условиям и блестяще справляется со всеми поставленными задачами.»

Объединенный университет:

Более 15000 студентов,

Более 3500 сотрудников,

1000 кандидатов наук,

7 членов-корреспондентов и действительных членов РАН.

Все ступени высшего профессионального образования: бакалавриат, специальность, магистратура, аспирантура.

: 55 ° 43’37.8 «ю.ш. 37 ° 36’25.2» дюйм. и т. д. / 55.727167 ° с.ш. 37,607 ° в. Д. И т. Д. (G) (O) (I) 55,727167 , 37.607

Московский государственный горный университет (МГГУ), ранее Московская горная академия с 1918 по 1929 год, Московская горная академия имени Сталина с 1929 по 1930 год, Московский горный институт с 1930 по 1962 год и с 1966 по 1993 год, Москва Институт радиоэлектроники и горной электромеханики с 1962 по 1966 год — федеральное государственное бюджетное образовательное учреждение высшего профессионального образования Российской Федерации.Основан 4 сентября 1918 года.

История

Организацию создания Академии осуществляла комиссия во главе с бывшим деканом горного факультета Нижегородского политехнического института Дмитрием Николаевичем Артемьевым. В 1919 году он стал первым ректором Московской государственной администрации.

Создание Академии было поручено организационной комиссии в составе Д. Н. Артемьева, Г. В. Ключанского, Н. М. Федоровского, М. К.Зиглер и Дж. Я. Энслен. Это были известные специалисты в области геологии и горного дела, впоследствии ставшие преподавателями Академии, возглавлявшими кафедры. Комиссия занималась обустройством выделенного под академию здания по ул. Б. Калужской, 14 (ныне Ленинский проспект, 6), бывшей Мещанской школы, по приглашению учителей, развивающим программам, приемом учеников. Среди претендентов были как вчерашние школьники, так и в основном люди, которые уже работали на заводах, шахтах, служили в армии.Знаний многим явно не хватало, но было огромное желание освоить профессии, необходимые в мирной жизни … Поэтому сразу пришлось решать вопрос об организации подготовительного курса … Позже, в 1922 году, его заменили на рабочая школа.

Постановление о создании академии на базе горного факультета подписано заместителем председателя Совета Народных Комиссаров А.И. Рыковым 4 сентября 1918 года. Торжественное открытие МГА состоялось 12 января 1919 года. со вступительным словом выступил известный геолог и писатель, академик Владимир Афанасьевич Обручев.Владимир Афанасьевич преподавал в Мосгосадминистрации с 1921 по 1929 год.

В сентябре 1921 года горное отделение академии состояло из трех факультетов — горного, геологоразведочного и металлургического. В 1922 году ректором Московской государственной администрации стал Иван Михайлович Губкин (после отъезда Д.Н. Артемьева в эмиграцию). Первая защита дипломных работ состоялась в 1923 году. В декабре 1929 года, через 10 лет после образования Академии, ей было присвоено имя И.В. Сталин.В 1929 году были созданы три новых факультета — нефтяного, торфяного и цветных металлов.

  • 1930 — создание на базе Московской горной академии шести самостоятельных институтов: горного института, института черной металлургии, нефтяного института, торфяного института, института цветных металлов и золота, геологоразведочного. институт. Горный институт был назначен правопреемником MGA.
  • 1941 г. — 200 сотрудников и преподавателей МГИ пополнили ряды первого подразделения народного ополчения.
  • 1945-1947 — участие в восстановлении Фрайбергской горной академии.
  • 1955-1962 гг. — участие студентов в освоении целины.
  • 1962 г. — МГИ преобразован в Московский институт радиоэлектроники и горной электромеханики (МИРГЕМ).
  • 1966 — МИРГЕМ реорганизован в МГИ.
  • 1978 г. — создан Эльбрусский учебно-экспериментальный центр.
  • 1987 — МГИ — первый советский университет, демократически избравший ректора.Член-корреспондент избран ректором. РАН, профессор Л.А. Пучков. В том же году в университете был организован Учебно-методический совет по высшему горному образованию … В его задачу входила организация работы горных вузов по подготовке инженерных и научных кадров.
  • 1988 г. — образован в МГИ НИИ Учебный центр фундаментальных и прикладных исследований в области горных наук.
  • 1990 г. — создан факультет довузовской подготовки.
  • Июнь 1993 г. — МГИ преобразован в Московский государственный горный университет (МГГУ).
  • 1993 г. — основано издательство Московского Государственного Гуманитарного Университета.
  • 1996 г. — первый выпуск бакалавров горного дела и менеджмента.
  • 2012 — Московский горный университет присоединен к НИТУ «МИСиС» как структурное подразделение.

При участии вуза в разные годы были созданы Карагандинский, Кемеровский, Пермский и Тульский горные институты.

Реакторы

  • 1919-1921 — Артемьев Д.Н.
  • 1922-1930 — Губкин И.М.
  • 1930-1933 — Ю.Ю. Эрлих
  • 1933-1936 — Терпигорев А.М.
  • 1962-1987 — Ржевский В.В.
  • 1987-2007 — Пучков Л.А.
  • 2007-2012 — Корчак А.В.
  • с 2012 г. — Ю. Дмитрак В.В. (и.о. ректора)

Реорганизация

  • Технология, механизация и организация открытых горных работ (ТО)
  • Технологии подземной разработки рудных и неметаллических месторождений (ТПР)
  • Маркшейдерское дело и геодезия (ГГ)
  • Геология

Горно-электромеханическое (ГЭМ)

  • Горные машины и оборудование (ГМО)
  • Наземные аппараты (НТС)
  • Горная механика и транспорт (MOP)
  • Технология машиностроения и ремонт горных машин (ТМ)
  • Горно-транспортные системы (ТСГП)
  • Электрификация и энергоэффективность горнодобывающей промышленности (горнодобывающая промышленность)
  • Технология художественной обработки (TX)
  • Сопротивление материалов
  • Теоретическая и прикладная механика

Физико-технический (FT)

Основан 16 марта 1967 года по инициативе ректора МГИ, академика В.В. Ржевский. В составе факультета 9 кафедр, в том числе 5 выпускных.

  • Физика горных пород и процессов (ГФ-1)
  • Физико-технический контроль горных процессов (ГФ-2)
  • Переработка полезных ископаемых (OPI)
  • Взрывоопасное дело (ВД)
  • Среда инженерной защиты (ИЗОС)
  • Высшая математика
  • Физика
  • Химия
  • Философия и культурология

Известные выпускники

  • Сергей Белоголовцев — российский телеведущий, актер, комик, телережиссер, шоумен.
  • Борис Братченко — советский партийный и государственный деятель, заместитель председателя Совета Министров, председатель Госплана Казахской ССР, министр угольной промышленности СССР.
  • Евгений Вайсброт — советский переводчик с польского.
  • Вадим Варшавский — известный российский бизнесмен и политик.
  • Лев Гертман — горный инженер — директор 1 ранга, профессор Ташкентского политехнического института.
  • Алексей Исаев — советский двигателестроитель, главный конструктор ОКБ №2 (КБХМ им. А. М. Исаева).
  • Павел Кабанов — КВНист, российский актер театра и кино, шоумен, пародист, телеведущий.
  • Александр Леман — советский и российский чертежник, ученый.
  • Владимир Милов — российский политический деятель, председатель Общероссийского общественного объединения «Демократический выбор», один из основателей коалиции «За Россию без произвола и коррупции». Заместитель министра энергетики России в мае-октябре 2002 г.
  • Владимир Михайлов — советский ученый, профессор, доктор технических наук, заслуженный деятель науки и техники РСФСР.
  • Оника Дмитрий — советский государственный деятель, организатор угольной промышленности СССР, доктор технических наук. Депутат Верховного Совета СССР.
  • Михаил Протодьяконов — советский горный ученый. Заслуженный деятель науки и техники РСФСР.
  • Ресин Владимир Владимирович — Первый заместитель Мэра Москвы в Правительстве Москвы, руководитель Комплекса архитектуры, строительства, развития и реконструкции города Москвы.
  • Владимир Ржевский — советский ученый, академик РАН (1991 г .; академик АН СССР с 1981 г.).Ректор Московского горного института с 1962 по 1987 год.
  • Григорий Ряжский — российский писатель, сценарист и продюсер.
  • Василий Трушин — советский и российский государственный деятель, инженер, геолог.
  • Михаил Степанов — российский кинорежиссер, актер театра и кино.
  • Федор Черенков — советский и российский футболист.
  • Николай Шацкий — геолог-тектонист, директор.

Заметки (редактировать)

Ссылки

Высшие учебные заведения Москвы
Государственные университеты (- медицинские, — военные)
Университеты
Академии
Учреждения
Зимние сады
Филиалы
Негосударственные университеты (- духовные)
Университеты
Академии
Учреждения

Категории:

  • Университеты по алфавиту
  • Высшие учебные заведения Москва по алфавиту
  • Московский государственный горный университет
  • Объекты им. Сталина

Фонд Викимедиа.2010.

Все университеты Колумбийский университет Морской колледж Новиконтас Хакасский государственный университет им. Н.Ф. Катанова Хакасский технический институт (филиал Сибирского федерального университета) Каспийский государственный инженерно-технический университет им. Есеновой Актюбинский региональный государственный университет им. К. Жубанова Западно-Казахстанский государственный медицинский университет. М. Оспанова Алматинский университет менеджмента Алматинский государственный колледж энергетики и электронных технологий Алматинский технологический университет Алматинский университет энергетики и связи Казахская академия транспорта и коммуникаций им.М. Тынышпаева Казахская головная архитектурно-строительная академия Казахская национальная академия искусств им. Т. Жургеновой, Казахский национальный аграрный университет, Казахский национальный медицинский университет. С. Д. Асфендиярова Казахский национальный педагогический университет им. Казахский национальный технический университет имени Абая. К. И. Сатпаева Казахский национальный университет им. Казахский университет аль-Фараби международные отношения и мировые языки им. Абылай хана Казахстанский институт менеджмента, экономики и прогнозирования Казахстанско-Британский технический университет Казахстанско-Немецкий университет Казахстанско-Российский медицинский университет Международный университет информационных технологий Новый экономический университет им.Т. Рыскулова Университет международного бизнеса Turan University Донбасский государственный технический университет Альметьевский государственный нефтяной институт Арзамасский государственный педагогический институт имени А.П. Гайдара Арзамасский политехнический институт (филиал НГТУ) Армавирская государственная педагогическая академия Армавирский лингвистический университет Северный (Арктический) федеральный университет им. Северный государственный медицинский университет им. М.В. Ломоносова, Евразийский национальный университет имени М.В. Л.Н. Гумилева Казахский агротехнический университет имени С.Сейфуллина Казахский гуманитарно-правовой университет Казахский технологический университет и бизнес-медицинский университет Астана Астраханский государственный архитектурный университет строительства Астраханский государственный медицинский университет Астраханский государственный технический университет Азербайджанский медицинский университет Балаковский институт инженерии, технологии и менеджмента Барановичский государственный университет Алтайская академия экономики и права Алтай Государственная академия культуры и искусств Алтайский государственный аграрный университет Алтайский государственный медицинский университет Алтайский государственный педагогический университет Алтайский государственный технический университет им. И.И.Ползунова Алтайский государственный университет Алтайский филиал РАНХиГС (СибАГС АФ) Алтайский институт экономики и права Колледж 103 Белоцерковский национальный аграрный университет Белгородская государственная сельскохозяйственная академия имени В.Я. Горина Белгородский государственный институт искусства и культуры Белгородский государственный национальный исследовательский университет Белгородский государственный технологический университет имени В.Г. Шухова Белгородский университет кооперация, экономика и право Белгородский юридический институт МВД России Бердянский государственный педагогический университет им. Осипенко Бердянский университет управления и бизнеса Бийский технологический институт (филиал АГТУ им. Ползунова) Киргизская государственная медицинская академия им. .И.И.К. Ахунбаева Кыргызский государственный университет строительства, транспорта и архитектуры Кыргызский национальный университет имени Ж. Баласагына Кыргызско-Российская академия образования Кыргызско-Российский славянский университет им. Ельцина Амурская государственная медицинская академия Амурский государственный университет Дальневосточный государственный аграрный университет Бокситогорский институт (филиал Ленинградского государственного университета им. А.С. Пушкина) Братский государственный университет Брестский государственный технический университет Брестский государственный университет им. Пушкина Брянская государственная инженерно-технологическая академия Брянский государственный аграрный университет Брянский государственный технический университет Брянский государственный университет имени академика И.Брянский институт менеджмента и бизнеса Брянского филиала РАНХиГС (ORAGS BF) Великолукская государственная академия физической культуры и спорта Великолукская государственная сельскохозяйственная академия Винницкий государственный педагогический университет имени М. Коцюбинского Винницкий национальный аграрный университет Винницкий национальный медицинский университет имени Н.И. Пирогова Винницкий национальный технический университет Винницкий торгово-экономический институт (филиал КНТЭУ) Винницкий финансово-экономический университет Витебская государственная академия ветеринарной медицины Витебский государственный медицинский университет Витебский государственный технологический университет Витебский государственный университет им.М. Машерова Владивостокский государственный университет экономики и сервиса Дальневосточный государственный технический рыбохозяйственный университет Дальневосточный государственный технический университет Дальневосточный федеральный университет Адмирал Г.И. Тихоокеанский государственный медицинский университет им. Невельского Горный государственный аграрный университет Северо-Кавказский горно-металлургический технологический университет (СКГМИ) Северо-Осетинская государственная медицинская академия Северо-Осетинский государственный университет имени К. Хетагурова Владимирский государственный университет. Столетов Владимирский филиал РАНХиГС Волгоградская государственная академия физической культуры Волгоградский государственный аграрный университет Волгоградский государственный архитектурно-строительный университет Волгоградский государственный институт культуры и искусства Волгоградский государственный медицинский университет Волгоградский государственный социально-педагогический университет Волгоградский государственный технический университет Волгоградский государственный Университет Волгоградский институт бизнеса Волгоградский филиал РАНХиГС Волгодонский инженерно-технический институт НИЯУ МИФИ Волжский политехнический институт (филиал ВолгГТУ) Волковысский педагогический институт им.Купара ГрГУ Вологодская государственная молочная академия имени В.И. Н.В. Верещагина Вологодский государственный университет Вологодский институт права и экономики ФСИН России Педагогический институт ВоГУ Воронежская государственная лесохозяйственная академия Воронежская государственная медицинская академия имени В.И. Н.Н. Бурденко Воронежский государственный аграрный университет имени императора Петра I Воронежский государственный архитектурно-строительный университет Воронежский государственный институт физической культуры Воронежский государственный медицинский университет имени Н.Н. Бурденко Воронежский государственный педагогический университет Воронежский государственный технический университет Воронежский государственный университет Воронежский государственный университет инженерные технологии Воронежский институт МВД Российской Федерации Воронежский экономико-правовой институт Институт менеджмента, маркетинга и финансов Международный институт компьютерных технологий Государственный институт экономики , Финансы, право и технологии Глазовский государственный педагогический институт имени В.Г. Короленко Глуховский национальный педагогический университет имени А.Довженко Белорусский государственный университет транспорта Белорусский торгово-экономический университет потребительской кооперации Гомельский государственный аграрно-экономический колледж Гомельский государственный медицинский университет Гомельский государственный технический университет им. НА. Сухого Гомельский государственный университет имени Франциска Скорины Белорусская государственная сельскохозяйственная академия Горловский государственный педагогический институт иностранных языков ДГПУ Горно-Алтайский государственный университет Гродненский государственный медицинский университет Гродненский государственный университет имени Ю. Купалы Чеченский государственный университет Днепропетровская государственная финансовая академия Днепропетровская медицинская академия Министерства здравоохранения Российской Федерации Здравоохранение Украины Днепропетровский государственный аграрно-экономический университет Днепропетровский государственный университет внутренних дел Днепропетровский национальный университет железнодорожного транспорта им.Академика В. Лазаряна Днепропетровский национальный университет имени Олеси Гончара Днепропетровский университет им. Национальная металлургическая академия Украины им. А. Нобеля Национальный горный университет Приднепровская государственная академия строительства и архитектуры Украинский государственный химико-технологический университет Московский государственный физико-технический университет (МФТИ) Академия гражданской защиты МЧС ДНР Донбасская юридическая академия Донецкий институт железнодорожного транспорта Донецкого национального медицинского университета имени М.Донецкий национальный университет имени Горького Донецкий национальный университет экономики и торговли. Донецкий техникум промышленной автоматизации им. М. Туган-Барановского Донецкий юридический институт МВД Украины Дрогобычский государственный педагогический университет имени И. Франко Таджикский государственный медицинский университет. Абуали ибни Сино (Авицены) Таджикский государственный педагогический университет имени Садриддина Айни Евпаторийский институт социальных наук (филиал КФУ) Екатеринбургский государственный театральный институт Институт международных отношений Колледж железнодорожного транспорта Российский государственный профессионально-педагогический университет Уральская государственная архитектурно-художественная академия Уральская государственная консерватория им. после М.П. Мусоргский Уральский государственный аграрный университет Уральский государственный горный университет Уральский государственный лесотехнический университет Уральский государственный медицинский университет Уральский государственный педагогический университет Уральский государственный университет путей сообщения Уральский государственный экономический университет Уральский государственный юридический университет Уральский институт бизнеса им. И.А.Ильина Уральский институт государственной противопожарной службы МЧС России Уральский торгово-правовой институт Уральский институт РАНХиГС (УРАГС) Уральский институт экономики, управления и права Уральский техникум автомобильного транспорта и сервиса Уральский технический институт связи и информатики (филиал СибГУТИ) Уральский федеральный университет имени Б.Н. Ельцина Уральский финансово-юридический институт «УПИ» Елабужский институт Казанского (Приволжского) федерального университета (ранее ЕГПУ) Елецкий государственный университет имени И.А. Бунин Ереванский государственный университет Житомирский государственный технологический университет Житомирский государственный университет им. Иваны Франко Житомирский институт сестринского дела Житомирский национальный агроэкологический университет Запорожский автомобильный техникум Запорожская государственная инженерная академия Запорожский государственный медицинский университет Запорожский институт экономики и информационных технологий Запорожский национальный технический университет Запорожский национальный технический университет Институт искусств и информационных технологий Московского филиала Ивано-Франковский национальный медицинский университет Ивано-Франковский национальный технический университет нефти и газа Прикарпатский национальный университет им.В. Стефаника Ивановская государственная архитектурно-строительная академия Ивановская государственная медицинская академия Ивановская государственная сельскохозяйственная академия Ивановский государственный университет Ивановский государственный химико-технологический университет Ивановский государственный энергетический университет. В И. Ленинский текстильный институт ИвГПУ Московский региональный институт управления и права Ижевская государственная медицинская академия Ижевская государственная сельскохозяйственная академия Ижевский государственный технический университет им. М.Т. Калашникова Камский институт гуманитарных и инженерных технологий Удмуртский государственный университет Удмуртский республиканский социально-педагогический колледж Измаильский техникум механизации и электрофикации сельского хозяйства Байкал Государственный университет Иркутский государственный аграрный университет имени В.И.А.А. Ежевского Иркутский государственный лингвистический университет Иркутский государственный медицинский университет Иркутский государственный университет Иркутский государственный университет путей сообщения Иркутский национальный исследовательский технический университет Педагогический институт (филиал ИГУ) Сибирская академия права, экономики и управления Институт права (филиал ИГУ) Национальный университет государственной налоговой службы им. Украина Межрегиональный открытый социальный институт Марийского государственного университета Приволжский государственный технологический университет Академия социального образования Институт социально-гуманитарных знаний Институт экономики и финансов КФУ Институт экономики, управления и права Казанская государственная академия ветеринарной медицины им.Казанская государственная консерватория (академия) им. Э. Баумана имени Н.Г. Жиганова Казанский государственный аграрный университет Казанский государственный архитектурно-строительный университет Казанский государственный медицинский университет Казанский государственный университет культуры и искусств Казанский государственный энергетический университет Казанский кооперативный институт (филиал РУК) Казанский национальный исследовательский технический университет имени В.И. Туполева Казанский национальный исследовательский технологический университет Казанский федеральный университет Поволжская государственная академия физической культуры, спорта и туризма Татарский государственный гуманитарно-педагогический университет Университет управления ТИСБИ Калачеевский сельскохозяйственный колледж Балтийская государственная академия рыбного флота Балтийский информационный колледж Балтийский федеральный университет имени А.Н. Канта Калининградский государственный технический университет Санкт-Петербургский университет сервиса и экономики (Калининградский филиал) Калужский государственный университет имени И.И. К.Э. Циолковского Калужский филиал РАНХиГС Каменец-Подольский национальный университет им. И. Огиенко Подольский государственный аграрно-технический университет Камышинский технологический институт (филиал ВолгГТУ) Карагандинский государственный медицинский университет Карагандинский государственный технический университет Карагандинский государственный университет им. Е.А. Букетовой Карагандинский университет Болашак Карагандинский университет экономики Университет Сулеймана Демиреля Кемеровский государственный медицинский университет (ранее КемГМА) Кемеровский государственный сельскохозяйственный институт Кемеровский государственный университет Кемеровский государственный университет культуры и искусств Кемеровский технологический институт пищевой промышленности Кузбасский государственный технический университет Кузбасский государственный технический университет Кузбасский государственный институт экономики и права Керченский государственный морской технологический университет Государственный университет им. Телекоммуникации Государственный экономический и технологический университет транспорта Европейский университет финансов, информационные системы менеджмента и бизнеса Киевская государственная академия водного транспорта им.Конашевич-Сагайдачный Киевский медицинский университет УАНМ Киевский национальный лингвистический университет Киевский национальный торгово-экономический университет Киевский национальный университет им. Киевский национальный университет культуры и искусств им. Т. Шевченко Киевский национальный университет строительства и архитектуры Киевский национальный университет театра, кино и телевидения имени И.К. Карпенко-Карого Киевский национальный университет технологии и дизайна Киевский национальный экономический университет имени И.К. Киевский славянский университет им. В. Гетьмана Киевский университет.Б. Гринченко Киевский юридический университет Национальной академии наук Украины Киевский университет туризма, экономики и права Международный научно-технический университет им. Ю. Бугая Межрегиональная академия управления персоналом Национальная академия внутренних дел Украины Национальная академия руководящих кадров культуры и искусств Национальная академия статистики, учета и аудита Национальная академия управления Национальная музыкальная академия Украины им. Национальный авиационный университет имени П.И. Чайковского Национальный медицинский университет имени А.Национальный педагогический университет им. А.А. Богомольца имени М.П. Драгоманова Национальный технический университет Украины «Киевский политехнический институт» Национальный университет транспорта Национальный университет «Киево-Могилянская академия» Национальный университет биоресурсов и природопользования Национальный университет пищевых технологий Национальный университет физического воспитания и спорта Украины Открытый международный университет развития человека Украина Украинский государственный Университет финансов и международной торговли Самарская государственная сельскохозяйственная академия Волго-Вятский институт (филиал Московской государственной юридической академии) Вятская государственная сельскохозяйственная академия Вятский государственный гуманитарный университет Вятский государственный университет Вятский социально-экономический институт Московский финансово-правовой университет Кировский филиал Кировоградская летная академия Национальный авиационный университет Кировоградский государственный педагогический университет имени В.Винниченко Кировоградский институт регионального отделения и экономики Кировоградский национальный технический университет Государственный аграрный университет Молдовы Государственный медицинский и фармакологический университет имени Николая Тестемицану Международный независимый университет Молдовы КОВРОВСКАЯ ГОСУДАРСТВЕННАЯ ТЕХНОЛОГИЧЕСКАЯ АКАДЕМИЯ им. В.А. Дегтярева Филиал Коломенского института МГМУ Московский областной социально-гуманитарный институт Амурский гуманитарно-педагогический государственный университет Комсомольский-на-Амуре государственный технический университет Конотопский институт СумГУ Финансово-технологическая академия Костанайский государственный университет им. Ахмета Байтурсынова Костромской государственный технологический университет Костромской государственный университет им.Некрасова Донбасская государственная машиностроительная академия Донбасская национальная академия строительства и архитектуры Донецкий национальный технический университет Индустриальный институт Красной армии ДонНТУ Краснодарский государственный университет культуры и искусств Кубанский государственный аграрный университет Кубанский государственный медицинский университет Кубанский государственный технологический университет Кубанский государственный университет Кубанский государственный университет физической культуры , Спорт и туризм Кубанский социально-экономический институт Современная гуманитарная академия Гуманитарный институт СибФУ Строительный институт СибФУ Архитектурно-проектный институт СибФУ Институт горного, геологии и геотехнологий СибФУ Естественно-гуманитарный институт Сибирский федеральный университет Институт инженерной физики и радиоэлектроники Сибирский Федеральный Университетский институт космических и информационных технологий Сибирский федеральный университет Институт нефти и газа Сибирский федеральный университет Институт педагогики, психологии и социологии Сибирский федеральный университет Институт бизнеса Pr ocess Управление и экономика Сибирский федеральный университет Институт филологии и языковой коммуникации Сибирский федеральный университет Институт фундаментальной биологии и биотехнологии Сибирский федеральный университет Институт цветных металлов и материаловедения Сибирский федеральный университет Институт экономики, менеджмента и природопользования Сибирский федеральный университет Красноярская государственная академия им. Музыка и театр Красноярская государственная архитектурно-строительная академия Сибирский федеральный университет Красноярский государственный аграрный университет Красноярский государственный медицинский университет имени В.Красноярский государственный педагогический университет имени В.П. Войно-Ясенецкого. Астафьева Красноярский институт железнодорожного транспорта — филиал ИрГУПС Политехнического института Сибирского федерального университета Сибирский государственный технологический университет Сибирский государственный научно-технический университет имени академика М.Ф. Решетнева Сибирский институт бизнеса, менеджмента и психологии Сибирский межрегиональный учебный центр Сибирский федеральный университет Торгово-экономический институт Сибирский федеральный университет Юридический институт Сибирский федеральный университет Кременчугский национальный университет имени М.Остроградский Криворожский национальный университет Криворожский экономический институт КНЭУ им. Авиационный технический колледж им. В. Гетьмана Курганская государственная сельскохозяйственная академия Курганский государственный университет им. Т. С. Мальцева Курская государственная сельскохозяйственная академия. пр. И. Иванова Курский государственный медицинский университет Курский институт социального образования Региональный финансово-экономический институт Юго-Западный государственный университет Тувинский государственный университет Лесосибирский педагогический институт (филиал ЮФУ) Липецкий государственный педагогический университет Липецкий государственный технический университет Лужский институт (филиал Ленинградского государственного университета им.С.С. Пушкина) Луганская государственная академия культуры и искусств Луганский государственный медицинский университет Луганский государственный университет внутренних дел имени А.С. E.A. Дидоренко Луганский государственный университет имени Владимира Даля Луганский национальный аграрный университет Луганский национальный университет имени Тараса Шевченко Восточноевропейский национальный университет им. Леси Украинки Луцкий национальный технический университет Львовская коммерческая академия Львовская национальная академия искусств Львовский государственный университет внутренних дел Львовский государственный университет физической культуры Львовский институт экономики и туризма Львовский национальный аграрный университет Львовский национальный медицинский университет им. Д.Галицкий Львовский национальный университет ветеринарной медицины и биотехнологии имени С.З. Гжицкого Львовский национальный университет имени И. Франко Национальный университет Львовская политехника Российская таможенная академия Северо-Восточный государственный университет Ингушский государственный университет Магнитогорский государственный технический университет имени Г. И. Носова Магнитогорский медицинский колледж им. ПФ. Надеждина Азовский морской институт Одесской национальной морской академии Донецкий государственный университет управления Мариупольский государственный университет Приазовский государственный технический университет Дагестанская государственная медицинская академия Дагестанский государственный педагогический университет Дагестанский государственный технический университет Дагестанский государственный университет Мелитопольский государственный педагогический университет.Таврический государственный агротехнологический университет им. Б. Хмельницкого Белорусская государственная академия искусств Белорусская государственная музыкальная академия Белорусская государственная академия связи Белорусский государственный аграрно-технический университет Белорусский государственный медицинский университет Белорусский государственный педагогический университет им. М. Танка Белорусский государственный технологический университет Белорусский государственный университет Белорусский государственный университет информатики и радиоэлектроники Белорусский государственный университет культуры и искусств Белорусский государственный университет физической культуры Белорусский государственный экономический университет Белорусский национальный технический университет институт информационных технологий БГУИР институт пограничной службы Республика Беларусь институт современных знаний им.ЯВЛЯЮСЬ. Широкова Международный государственный экологический университет. Международный университет им. А.Д. Сахарова Минский государственный высший радиотехнический колледж Минский государственный политехнический колледж Минский инновационный университет Минусинский колледж культуры и искусства Михайловский техникум им. А.Д. Мерзлова Белорусско-Российский университет Могилевский государственный университет. А.А. Кулешова Могилевский государственный продовольственный университет Мозырский государственный педагогический университет имени И.П. Шамякина Академический международный институт Академический юридический институт Академия Государственной противопожарной службы МЧС России Академия стандартизации, метрологии и сертификации Академия труда и социальных отношений Федерации независимых профсоюзов России Военно-воздушная инженерная академия им.пр. Н.Е. Жуковского Всероссийская академия внешней торговли Министерства экономического развития РФ Всероссийский государственный университет кинематографии. С.А.Герасимова «ВГИК» Высшее театральное училище (институт) им. М.С. Щепкина ГАПОУ колледж предпринимательства №11 Государственная академия славянской культуры Государственная классическая академия им. Маймонида Государственный академический университет Гуманитарный институт русского языка. В КАЧЕСТВЕ. Пушкинский государственный университет землеустройства Государственный университет управления Гуманитарный институт телевидения и радиовещания имени В.Литовчина Институт гуманитарного образования и информационных технологий Институт журналистики и литературного творчества Институт международного права и экономики имени А.С. Грибоедова Институт последипломного профессионального образования ФМБК (научный центр) Институт рыночной экономики, социальной политики и права Институт текстильной и легкой промышленности МГУТУ Институт туризма и гостеприимства Институт менеджмента и права Институт экономики и культуры Колледж градостроительства и сервиса №38 Колледж многоуровневого профессионального образования Литературный институт РАНХиГС им.ЯВЛЯЮСЬ. Горьковский медицинский институт повышения квалификации Медицинский колледж № 1 Международная академия бизнеса и менеджмента Международный институт экономики и права Институт международного права Московская академия астрологии Московская академия предпринимательства при Правительстве Москвы Московская академия экономики и права Московская государственная академия ветеринарной медицины и биотехнологии KI Скрябина Московская государственная академия водного транспорта Московская государственная академия коммунального хозяйства и строительства Московская государственная академия физической культуры Московская государственная консерватория.Московская государственная художественно-промышленная академия им. П.И. Чайковского Московская государственная юридическая академия им. Кутафина Московская гуманитарно-техническая академия Московская финансово-юридическая академия Московский авиационный институт (национальный исследовательский университет) Московский автомобильно-дорожный государственный технический университет Московский архитектурно-строительный институт Московский архитектурный институт (государственная академия) Московский банковский институт Московский горный институт (филиал НИТУ) МИСиС) Московский городской педагогический университет Московский городской психолого-педагогический университет Московский городской университет управления Правительство Москвы Московский государственный агроинженерный университет.В.П. Горячкина Московский государственный гуманитарно-экономический университет Московский государственный гуманитарный университет. Московский государственный индустриальный университет им. М.А.Шолохова Московский государственный институт индустрии туризма. Ю.А. Сенкевича Московский государственный институт радиотехники, электроники и автоматики (технический университет) Московский государственный институт электроники и математики (технический университет) Московский государственный колледж информационных технологий Московский государственный лингвистический университет Московский государственный машиностроительный университет «МАМИ» Московский государственный медико-математический университет Стоматология.А.И. Евдокимова Московский государственный региональный университет Московский государственный открытый университет. В.С. Черномырдина Московский государственный строительный университет Московский государственный технический университет гражданской авиации Московский государственный технический университет Московский государственный технологический университет им. Н.Э. Баумана «Станкин» Московский государственный университет геодезии и картографии Московский государственный университет дизайна и технологий Московский государственный университет им. М.В. Московский государственный университет инженерной экологии им. М.В. Ломоносова Московский государственный университет международных отношений МИД России (МГИМО) Московский государственный университет печати И.Федорова Московский государственный университет пищевых производств Московский государственный университет приборостроения и информатики Московский государственный университет прикладной биотехнологии Московский государственный университет инженерной экологии Московский государственный университет путей сообщения Московский государственный университет технологии и управления К.Г. Разумовского Московский государственный университет тонкой химической технологии им. М.В. Московский государственный университет экономики, статистики и информатики (МЭСИ) им. М.В. Ломоносова Московский гуманитарно-экономический институт Московский гуманитарный институт.Е.Р. Дашкова Московский гуманитарный университет Московский институт государственного и юридического права Московский институт предпринимательства и права Московский институт телевидения и радиовещания «Останкино» Московский международный университет Московский институт нового права Московский образовательный комплекс. В. Талалихина Московский государственный педагогический университет Московский психологический социальный университет Московский социально-экономический институт Московский технический университет связи и информатики Московский технологический институт «ВТУ» Московский университет.С.Ю. Витте (бывший Московский институт экономики, управления и права) Московский университет МВД России имени В.Я. Кикотя Московский финансово-промышленный университет Синергия Московский художественно-промышленный институт Московский экономический институт Музыкально-педагогический государственный институт им. Ипполитова-Иванова Национальный институт бизнеса Национальный исследовательский технологический университет МИСиС Национальный исследовательский университет Высшая школа экономики Национальный исследовательский университет МИЭТ Национальный исследовательский университет МЭИ Национальный исследовательский университет ядерный университет (МИФИ) Открытый университет Израиль в СНГ Педагогический институт физической культуры и спорта им. Московский городской педагогический университет Первый Московский государственный медицинский университет.ИХ. Сеченовский политехнический колледж имени П.А. Овчинникова Свято-Тихоновский гуманитарный университет Российская академия музыки Российская академия народного хозяйства и государственной службы при Президенте Российской Федерации Российская международная академия Туризм Российская открытая академия транспорта МИИТ Российский государственный аграрный университет Московская сельскохозяйственная академия Тимирязева Российская государственная геологоразведка Университет. С. Орджоникидзе Российский государственный гуманитарный университет Российский государственный социальный университет Российский государственный технологический университет.К.Э. Циолковского (МАТИ) Российский государственный торгово-экономический университет Российский государственный университет имени А.Н. Косыгина РГУ инновационные технологии и предпринимательство РГУ нефти и газа. ИХ. Губкина, Российский государственный университет правосудия, Российский государственный университет туризма и сервиса, Российский государственный университет физической культуры, спорта, молодежи и туризма (СКОЛИФК), Российский национальный исследовательский медицинский университет имени Н.И. Пирогова Российский новый университет Российский университет дружбы народов Русский университет театральное искусство Российский химико-технологический университет имени Д.И.Российский экономический университет имени Менделеева. Г.В. Плеханова столичная финансово-гуманитарная академия театральный институт им. Б.В.Щукина при Государственном академическом театре им. Е. Вахтангова Университет Российского инновационного образования Университет Российская Академия образования Федеральный институт повышения квалификации и переподготовки Финансовый университет при Правительстве Российской Федерации Школа-студия (институт) им. Вл. И. Немирович-Данченко во МХАТе. Мукачевский государственный университет им. А.П. Чехова Международный институт бизнес-образования Мурманский государственный гуманитарный университет Московский государственный лесной университет Московский кооперативный колледж Альтшул Российский университет кооперации Камская государственная инженерно-экономическая академия Набережно-Челнинский государственный торгово-технологический институт Набережно-Челнинский институт КФУ Набережно-Челнинский институт социо- Педагогические технологии и ресурсы Кабардино-Балкарского государственного университета имени Х.Бербекова Нанкинский технологический университет им. Н. Гоголя Немешаевский агротехнический колледж Нижневартовский государственный университет Нижнекамский химико-технологический институт Казанский государственный технологический университет Поволжская государственная академия водного транспорта Нижегородская государственная консерватория им. М.И. Глинки Нижегородская государственная сельскохозяйственная академия Нижегородская юридическая академия Нижегородский государственный архитектурно-строительный университет Нижегородский государственный инженерно-экономический университет Нижегородский государственный лингвистический университет им.Добролюбова Нижегородский государственный педагогический университет имени К. Минина Нижегородский государственный технический университет имени Р.Е. Алексеева Нижегородский государственный университет имени Н.И. Лобачевского Нижегородский институт менеджмента и бизнеса Нижегородский институт управления РАНХиГС Приволжский исследовательский медицинский университет (бывшая Нижегосударственная медицинская академия) Нижнетагильский государственный социально-педагогический институт (филиал РГПУ) Нижнетагильский технологический институт (филиал УрФУ) Национальный университет судостроения им. адм.Макарова Николаевский национальный аграрный университет Николаевский национальный университет имени В.А. Сухомлинский Черноморский государственный университет им. Петра Могилы Новгородский государственный университет им. Ярослава Мудрого Новокузнецкий институт (филиал КемГУ) Сибирский государственный индустриальный университет Государственный морской университет им. Адмирала Ф. Ф. Ушакова Институт катализа. Г.К. Борескова Новосибирская государственная консерватория имени М.И. Глинки Новосибирский государственный аграрный университет Новосибирский государственный архитектурно-строительный университет Новосибирский государственный медицинский университет Новосибирский государственный педагогический университет Новосибирский государственный технический университет Новосибирский государственный университет Новосибирский государственный университет архитектуры, дизайна и искусств (ранее НСАНА) Новосибирский государственный университет экономики и управления Новосибирский медицинский Колледж Новосибирский юридический институт (филиал ТГУ) Сибирская финансово-банковская академия Сибирский государственный университет водного транспорта Сибирский государственный университет геосистем и технологий Сибирский государственный университет путей сообщения Сибирский государственный университет телекоммуникаций и информатики Сибирский институт управления РАНХиГС Сибирский университет потребительская кооперация Южно-Российский государственный технический университет (Новочеркасский политехнический институт) (ЮРГТУ (НПИ)) Обнинский гуманитарный институт Обнинский институт атомной энергетики НИЯУ МИФИ Национальный университет Одесская морская академия (бывшая ОНМА) Национальный университет Одесская юридическая академия Одесская государственная академия строительства и архитектуры Одесская национальная академия пищевых технологий Одесская национальная академия связи.В КАЧЕСТВЕ. Попова Одесский государственный аграрный университет Одесский государственный экологический университет Одесский государственный экономический университет Одесский колледж корпоративных компьютеров Одесский национальный медицинский университет Одесский национальный морской университет Одесский национальный политехнический университет Одесский национальный университет. И. Южно-Украинский национальный педагогический университет им. И.И. Мечникова. Ушинский Озерский технологический институт Омской академии МВД России Омский государственный аграрный университет имени В.Омский государственный институт сервиса им. И. П. Столыпина Омский государственный педагогический университет Омский государственный технический университет Омский государственный университет имени Ф.М. Омский государственный университет путей сообщения им. Достоевского Омский экономический институт Омский юридический институт Сибирская автомобильно-дорожная академия Сибирский государственный университет физической культуры и спорта Государственный университет — учебно-научно-производственный комплекс (бывший ОрелГТУ) Медицинский институт Орловского государственного университета Орловский государственный институт искусств и культуры Орловский государственный институт экономики и торговли Орловский филиал РАНХиГС Оренбургский государственный аграрный университет Оренбургский государственный институт управления Оренбургский государственный медицинский университет Оренбургский государственный педагогический университет Оренбургский государственный университет Оренбургский институт (филиал МГЮА Кутафина) Орский гуманитарно-технический институт (филиал ОГУ) Орский медицинский колледж ГБПОУ Осташковский колледж Ошский технологический университет им. акад.ММ. Адышева Инновационный Евразийский университет Павлодарский государственный педагогический университет Павлодарский государственный университет им. С. Торайгырова Пензенский государственный университет Пензенская государственная сельскохозяйственная академия Пензенский государственный технологический университет Пензенский государственный университет Пензенский государственный архитектурно-строительный университет Переяслав-Хмельницкий государственный педагогический университет им. им. Г.С. Сковороды Западно-Уральский институт экономики и права Пермская государственная академия искусства и культуры Пермская государственная сельскохозяйственная академия имени Д.Н. Прянишникова Пермская государственная фармацевтическая академия Пермский государственный гуманитарно-педагогический университет Пермский государственный медицинский университет им. E.A. Пермский государственный национальный исследовательский университет имени Вагнера Пермский гуманитарно-технологический институт Пермский институт экономики и финансов Пермский национальный исследовательский политехнический университет Карельская государственная педагогическая академия Петрозаводская государственная консерватория имени А.К. Глазунова Петрозаводский государственный университет Северо-Казахстанский государственный университет имени М. Козыбаева Камчатский государственный технический университет Пинский государственный профессионально-технический колледж машиностроения Полесский государственный университет Полтавская государственная аграрная академия Полтавский национальный педагогический университет имени В.Полтавский национальный технический университет им. Г. Короленко. Ю. Кондратюка Полтавский университет экономики и торговли Украинская медицинская стоматологическая академия Псковский агротехнический колледж Псковский государственный университет Ленинградский государственный университет имени А.С. Пушкин Санкт-Петербургский государственный аграрный университет Пятигорский государственный лингвистический университет Пятигорский государственный технологический университет Пятигорский медико-фармацевтический институт (филиал ВолгГМУ) Северо-Кавказский институт РАНХиГС (СКАГС) Режевский политехнический международный экономико-гуманитарный университет.Национальный университет водного хозяйства и природопользования им. С. Демьянчука Ровенский государственный гуманитарный университет Академия архитектуры и искусств Южного федерального университета Донской государственный аграрный университет Донской государственный технический университет Институт сервиса и туризма (филиал ДГТУ) Институт менеджмента, бизнеса и права Ростов Государственная консерватория имени С.В. Рахманинова Ростовский государственный медицинский университет Ростовский государственный университет путей сообщения Ростовский государственный экономический университет «РИНХ» Ростовский институт защиты предпринимателей Ростовский юридический институт (филиал МЮ РПА) Южный федеральный университет Рыбинский государственный авиационный технический университет.П.А. Соловьева Рыбинское речное училище имени И.Н. Калашников Рыбницкий филиал Приднестровского государственного университета имени Т.Г. Шевченко Рязанский государственный агротехнологический университет имени Т.Г. Шевченко П.А. Костычева Рязанский государственный медицинский университет имени И.И. акад. И. Павлова Рязанский государственный радиотехнический университет Рязанский государственный университет им. С.А. Есенина Медицинский университет «РЕАВИЗ» Поволжская государственная социально-гуманитарная академия Поволжский государственный университет связи и информатики Самарская академия государственного и муниципального управления Самарская государственная академия культуры и искусств Самарская гуманитарная академия Самарский государственный университет архитектуры и строительства Самарский государственный медицинский университет Самарский государственный технический университет Самарский государственный университет путей сообщения Самарский государственный экономический университет Самарский институт — высшая школа приватизации и предпринимательства Самарский национальный исследовательский университет им. ак.С.П. Королев (бывший СГАУ, СумГУ) Самаркандский государственный медицинский институт Академия русского балета. И И. Ваганова Балтийская академия туризма и предпринимательства Балтийский государственный технический университет «ВОЕНМЕХ» Д.Ф. Устинова Балтийский гуманитарный институт Балтийский институт экологии, политики и права Военная академия связи им. СМ. Буденного военно-космическая академия им. Военно-медицинская академия им. А.Ф. Можайского им. СМ. Кирова Восточноевропейский институт психоанализа Государственная Полярная академия Государственный университет морского и речного флота им.ТАК. Макарова Институт специальной педагогики и психологии. Институт телевидения, бизнеса и дизайна им. Р. Валленберга Международный институт психологии и менеджмента Национальный государственный университет физической культуры, спорта и здоровья имени П.Ф. Лесгафта Национальный минерально-сырьевой университет «Горный» Национальный открытый институт Первый Санкт-Петербургский государственный медицинский университет имени И.И. И. Павлова Санкт-Петербургский государственный университет путей сообщения. Российский государственный гидрометеорологический университет Императора Александра I Российский государственный педагогический университет.А.И. Российская христианская гуманитарная академия им. Герцена Санкт-Петербургская государственная академия ветеринарной медицины Санкт-Петербургская государственная академия театрального искусства Санкт-Петербургская государственная консерватория им. Римского-Корсакова Санкт-Петербургская государственная медицинская академия имени И.И. Мечникова Санкт-Петербургская государственная химико-фармацевтическая академия Санкт-Петербургская государственная художественно-промышленная академия имени А.Л. Штиглица Санкт-Петербургский государственный архитектурно-строительный университет Санкт-Петербургский государственный институт психологии и социальной работы Санкт-Петербургский государственный лесотехнический университет им.СМ. Кирова Санкт-Петербургский государственный морской технический университет Санкт-Петербургский государственный педиатрический медицинский университет Санкт-Петербургский государственный политехнический университет Машиностроительный институт Санкт-Петербургский государственный технологический институт (технический университет) Санкт-Петербургский государственный технологический университет растительных полимеров Санкт-Петербургский государственный университет им. Торговля и экономика Санкт-Петербургский государственный университет Санкт-Петербургский государственный университет аэрокосмического приборостроения Санкт-Петербургский государственный университет гражданской авиации Санкт-ПетербургСанкт-Петербургский государственный университет информационных технологий, механики и оптики Санкт-Петербургский государственный университет кино и телевидения Санкт-Петербургский государственный университет культуры и искусств Санкт-Петербургский государственный университет низкотемпературных и пищевых технологий Санкт-Петербургский государственный университет сервиса и экономики Санкт-Петербургский государственный университет Университет телекоммуникаций проф. М.А.Бонч-Бруевича Санкт-Петербургский государственный университет технологии и дизайна Санкт-Петербургский государственный экономический университет (ранее ФИНЭК, ИНЖЕКОН)Петербургский государственный электротехнический университет «ЛЭТИ» Санкт-Петербургский гуманитарный университет профсоюзов Санкт-Петербургский институт внешнеэкономических связей, экономики и права Санкт-Петербургский институт гостеприимства Санкт-Петербургский институт управления и права Санкт-Петербургский политехнический университет Петра Великого ( бывший СПбГПУ) Санкт-Петербургский университет Государственная противопожарная служба МЧС России Санкт-Петербургский университет МВД России Санкт-Петербургский университет управления и экономики Санкт-ПетербургСанкт-Петербургский юридический институт Академии Генеральной прокуратуры Российской Федерации Санкт-Петербургский институт гуманитарного образования Северо-Западный государственный заочный технический университет Северо-Западный государственный медицинский университет им. Мечникова Северо-Западный институт управления РАНХиГС (СЗАГС) Смольный институт Российской академии образования Мордовский государственный педагогический институт имени М.Е.Евсевьева Мордовский государственный университет им. Им руководит Волжский институт им. Огарева. П.А. Столыпина РАНХиГС Саратовская государственная консерватория имени Л. В. Собиновой Саратовская государственная юридическая академия Саратовский государственный аграрный университет имени Н.И. Саратовский государственный медицинский университет им. Вавилова. В И. Разумовского Саратовский государственный технический университет имени Ю.А. Гагарина Саратовский государственный университет им. Н.Г. Чернышевский Саратовский социально-экономический институт ПРУП им. Плеханова (бывший СГГЭУ) Саровский государственный физико-технический институт Сахалинский государственный университет Севастопольский городской гуманитарный университет Севастопольский государственный университет Севастопольский национальный университет ядерно-энергетический и промышленный институт судостроения и арктической морской техники (Севмашвтуз) (филиал САФУ) Восточноукраинский национальный университет имени В.Даля Северский технологический институт НИЯУ МИФИ им. Шакарима Государственный университет Семей Казахский гуманитарно-правовой инновационный университет Академия биоресурсов и природопользования Академия строительства и архитектуры (филиал КФУ) Гуманитарно-педагогическая академия (филиал КФУ) Крымский инженерно-педагогический университет Крымский университет культуры, искусства и туризма Крымского федерального университета имени И.Н. Вернадского Медицинская Академия. Симферопольский университет экономики и управления им. С.И. Георгиевского Таврическая академия (филиал КФУ) Таврический национальный университет им.Донбасский государственный педагогический университет им. В.И. Вернадского Смоленская государственная сельскохозяйственная академия Смоленский государственный институт искусств Смоленский государственный медицинский университет Смоленский государственный университет Смоленский гуманитарный университет Сосновский сельскохозяйственный техникум Сочинский государственный университет Сочинский институт Российский университет дружбы народов Северо-Кавказский гуманитарно-технический институт Северо-Кавказский федеральный университет Ставропольский государственный университет Аграрный университет Ставропольский государственный медицинский университет Ставропольский государственный педагогический институт Старооскольский технологический институт (филиал НИТУ «МИСиС») Стерлитамакская государственная педагогическая академия Муромцевский лесотехнический техникум Сумской государственный педагогический университет имени И.Макаренко Сумский государственный университет Сумский национальный аграрный университет Украинская академия банковского дела Национального банка Украины Сургутский государственный педагогический университет Сургутский государственный университет Сургутский институт нефти и газа (филиал Тюменского индустриального университета) Коми республиканская академия государственной службы и управления Сыктывкарский государственный университет им. им. Питирима Сорокина Сыктывкарский лесотехнический институт (филиал СПбГЛТА) Инженерно-технологическая академия ЮФУ Таганрогский институт им.Чехова Тамбовский государственный технический университет Тамбовский государственный университет имени А.П.Г.Р. Державина Тамбовский колледж экономики и предпринимательства Тамбовский филиал РАНХиГС Таразский государственный университет им. М.Х. Дулати Институт биоорганической химии им. А. Садыкова Ташкентский государственный стоматологический институт Ташкентский университет Информационные технологии Ташкентский химико-технологический институт Тверская государственная сельскохозяйственная академия Тверской государственный медицинский университет Тверской государственный технический университет Тверской государственный университет Тверской институт экологии и права Тверской медицинский колледж Тернопольский государственный медицинский университет.И И. Горбачевского Тернопольский национальный педагогический университет имени В. Гнатюка Тернопольский национальный технический университет имени И. Пулюи Тернопольский национальный экономический университет Приднестровский государственный университет имени Т. Шевченко Тобольский государственный педагогический институт имени Д.И. Менделеева Поволжский университет им. В.Н. Татищева Поволжский государственный университет сервиса Тольяттинский государственный университет Сибирский государственный медицинский университет Томский архитектурно-строительный университет Томский государственный педагогический университет Томский государственный университет Томский государственный университет систем управления и радиоэлектроники Томский институт бизнеса Томский политехнический университет Институт ветеринарной медицины ЮГАУ (ранее УГАВМ ) Тульский государственный педагогический университет имени Л.Н. Толстого Тульский государственный университет Международный казахско-турецкий университет. Х.А. Яссавский государственный аграрный университет Северного Зауралья Тюменская государственная академия культуры, искусства и социальных технологий Тюменская государственная академия мировой экономики, управления и права Тюменский государственный архитектурно-строительный университет Тюменский государственный медицинский университет Тюменский государственный нефтегазовый университет Тюменский государственный Университет Закарпатский государственный университет Ужгородский национальный университет Восточно-Сибирская государственная академия культуры и искусств Восточно-Сибирский государственный университет технологии и менеджмента Институт авиационных технологий и менеджмента (филиал УлГТУ) Ульяновская государственная сельскохозяйственная академия имени П.А. Столыпина Ульяновский государственный педагогический университет имени И. Н. Ульянова Ульяновский государственный технический университет Ульяновский государственный университет Ульяновский институт гражданской авиации имени главного маршала авиации Б.П. Бугаева Ульяновское высшее авиационное училище гражданской авиации Уманский государственный педагогический университет имени П. Тычины Уманский национальный университет садоводства Западно-Казахстанский аграрно-технический университет имени Жангир Хана Западно-Казахстанский государственный университет имени Утемисовой Усинский политехнический колледж Приморская государственная сельскохозяйственная академия Уссурийский колледж технологий и менеджмента Школа педагогики ДВФУ Восточно-Казахстанский государственный технический университет имени Д.Серикбаева Восточно-Казахстанский государственный университет имени С. Аманжолова Башкирская академия государственной службы и управления при Президенте Республики Башкортостан Башкирский государственный аграрный университет Башкирский государственный медицинский университет Башкирский государственный педагогический университет имени М. Акмуллы Башкирский государственный университет Восточная экономико-правовая гуманитарная академия Уфимская государственная академия искусств имени З. Исмагилова Уфимский государственный авиационный технический университет Уфимский государственный нефтяной технический университет Уфимский государственный университет экономики и сервиса Ухтинский государственный технический университет Тюменский индустриальный университет Дальневосточный государственный гуманитарный университет Дальневосточный государственный медицинский университет Дальневосточный государственный университет путей сообщения Дальневосточный институт Отделение РАНХиГС (ДВАГС) Дальневосточный юридический институт МВД Российской Федерации Тихоокеанский государственный университет Хабаровский государственный институт искусства и культуры Хабаровский государственный университет экономики и права Хабаро Вск Институт инфокоммуникаций (филиал СибГУТИ) Ханты-Мансийская государственная медицинская академия Югорский государственный университет Национальный аэрокосмический университет имени Н.Национальный технический университет им. Е. Жуковского Харьковский политехнический институт Национальный университет гражданской защиты Украины Национальный фармацевтический университет Национальный юридический университет имени Ярослава Мудрого Украинская государственная академия железнодорожного транспорта Украинская инженерно-педагогическая академия Харьковская государственная академия дизайна и искусств Харьковская государственная академия им. Культура Харьковская государственная академия физической культуры Харьковская государственная зоологическая ветеринарная академия Харьковская гуманитарно-педагогическая академия Харьковский государственный университет питания и торговли Харьковский гуманитарный университет Украинская народная академия Харьковский институт банковского дела УБР НБУ Харьковский институт финансов (филиал УГУФМТ) Харьковский национальный автомобильно-дорожный университет Харьков Национальный аграрный университет.В.В. Докучаева Харьковский национальный медицинский университет Харьковский национальный педагогический университет. G.S. Сковороды Харьковский национальный технический сельскохозяйственный университет. П. Василенко Харьковский национальный университет внутренних дел Харьковский национальный университет городского хозяйства имени А.Н. Харьковский национальный университет им. Бекетова. Харьковский национальный университет искусств им. В. Н. Каразина. И. Котляревского Харьковский национальный университет радиоэлектроники Харьковский национальный университет строительства и архитектуры Харьковский национальный экономический университет.С. Кузнец Харьковский патентно-компьютерный колледж Харьковский торгово-экономический институт (филиал КНТЭУ) Херсонская государственная морская академия Херсонский государственный аграрный университет Херсонский государственный университет Херсонский национальный технический университет Академия гражданской защиты МЧС России Московский государственный университет культуры и искусств Хмельницкий национальный университет Хмельницкий Университет управления и права Худжандский государственный университет им. П.И. Чайковского Государственный институт физической культуры им. П.И. Чайковского (филиал ИрГТУ) Чебоксарский кооперативный институт (филиал РУК) Чувашская государственная сельскохозяйственная академия Чувашский государственный педагогический университет имени И.И.Яковлевой Чувашский государственный университет имени И. Ульянова Российско-Британский институт управления Уральский государственный университет физической культуры Уральский социально-экономический институт Академии труда и социальных отношений ФНПР Челябинская государственная агроинженерная академия Челябинская государственная академия культуры и искусств Челябинский государственный педагогический университет Челябинский государственный университет Челябинский институт экономики и права . М.В. Ладошина Челябинский филиал РАНХиГС Черноморский флот Челябинский юридический институт МВД России Южно-Уральский государственный медицинский университет Министерства здравоохранения Российской Федерации (ранее ЧелГМА) Южно-Уральский государственный университет Южно-Уральский институт управления и Экономика Южно-Уральский профессиональный институт Саяно-Шушенский филиал Сибирского федерального университета Черемховский медицинский колледж Институт управления и информационных технологий (филиал СПбГПУ) Череповецкий государственный университет Черкасский государственный технологический университет Черкасский институт пожарной безопасности имени Героев Чернобыля Черкасский национальный университет имени Б. .Хмельницкого Черниговский государственный институт экономики и управления Черниговский национальный педагогический университет. T.G. Шевченко Черниговский национальный технологический университет Буковинский государственный медицинский университет Черновицкий национальный университет имени Юрия Федьковича Чистопольский филиал «Восток» Казанского национального исследовательского технического университета имени А.Н. Туполева — Забайкальский аграрный институт им. К.А.И. (филиал ИрГСХА) Забайкальский государственный университет Забайкальский институт железнодорожного транспорта , филиал ИрГУПС Читинская государственная медицинская академия Читинский институт Байкальского государственного университета экономики и права Шадринский государственный педагогический институт Институт сервиса и предпринимательства ДГТУ Южно-Российский гуманитарный институт Мирасский университет Южно-Казахстанская медицинская академия Южно-Казахстанский государственный университет.М. Ауэзова Калмыцкий государственный университет Энгельсский технологический институт Юргинский технологический институт Томский политехнический университет Северо-Восточный федеральный университет имени М.К. Аммосова Международный университет бизнеса и новых технологий Ярославская государственная сельскохозяйственная академия Ярославский государственный медицинский университет Ярославский государственный педагогический университет имени К.Д. Ушинского Ярославский государственный театральный институт Ярославский государственный технический университет Ярославский государственный университет имени П.Г. Демидова

Московский государственный горный университет вошел в состав Национального исследовательского технологического университета «МИСиС».Объединенный университет получил лицензию на право ведения деятельности по всем образовательным программам МИСиС и МГГУ и свидетельство о государственной аккредитации.

В соответствии с законодательством Российской Федерации все права и обязанности Московского государственного гуманитарного университета переданы НИТУ «МИСиС». Без изменений остались: форма и вид обучения; специальность, направление обучения, специализация, профиль, названия программ, а также стоимость обучения для студентов, обучающихся на платной основе.

В контексте формирования единого вуза консолидируется весь факультет. Уже сегодня студенты объединенного вуза получают доступ к развитой исследовательской и социальной инфраструктуре МИСиС и МГГУ, возможностям высокотехнологичного лабораторного комплекса и площадкам для внеклассных занятий. Улучшатся условия проживания в общежитиях.

В ходе реорганизации произошла интеграция сильнейших научно-педагогических школ, которые будут дополнять друг друга и, опираясь на материально-техническую базу мирового уровня, будут активно развиваться.

«Конечно, работа по реорганизации далась нам нелегко. Мировая практика показывает, что объединение университетов всегда болезненно, но мы уверены, что этот процесс принесет положительные результаты.

Вместе мы должны работать в области повышения качества образования, укрепления сотрудничества с вертикально интегрированными компаниями горно-металлургического комплекса и выхода на более широкий рынок труда для выпускников, повышения их конкурентоспособности как в России, так и за рубежом », — прокомментировала ректор НИТУ «МИСиС» Алевтина Черникова.

«Исходя из одного Алма Матер — Московская горная академия — в 1918 году и имея общие исторические и академические корни, МИСиС и МГГУ развивались автономно. Сегодня на российском рынке высшего образования каждый из вузов по праву является лидером в своей области.

Объединив наши усилия, мы получим уникальный синергетический эффект: наши образовательный и исследовательский секторы будут дополнять друг друга, что даст нам все шансы войти в сотню лучших мировых университетов и выйти в лидеры своей специализации.Сохранив все лучшее в структуре объединенного университета, МИСиС и МГГУ станут частью международного бренда », — прокомментировал и.о. ректора МГУ Вадим Петров

.

Металлургия и горнодобывающая промышленность всегда были тесно связаны. У успешных предприятий есть вертикально интегрированные крупные компании, которые не хотят продавать полуфабрикаты: не руду, не концентраты, а металл. По мнению ведущего российского горного специалиста, председателя совета директоров и научного директора научно-производственной корпорации «Механобр-Техника», члена-корреспондента РАН Леонида Вайсберга, интеграция горняков, металлургов и потребителей в современных условиях — это важно и очевидно.

«От того, как работают горняки и металлурги, напрямую зависят свойства того, как будет работать карданный вал вашего автомобиля, и от этого зависит качество продукта», — отмечает эксперт. университет », а также входит в программу 5 — 100 и при этом готов глубочайшим образом интегрироваться с горным институтом. Во-первых, это создаст полный комплекс для подготовки квалифицированных специалистов, во-вторых, МГХУ. автоматически получит статус исследовательского, а также будет включен в программу повышения конкурентоспособности.Уверен, что высокопрофессиональный коллектив вуза легко адаптируется к новым условиям и блестяще справляется со всеми поставленными задачами. «

Объединенный университет:

Более 15000 студентов,

Более 3500 сотрудников,

1000 кандидатов наук,

7 членов-корреспондентов и действительных членов РАН.

Все ступени высшего профессионального образования: бакалавриат, специальность, магистратура, аспирантура.

Выбор дополнительных предметов. Как выбрать предметы для экзамена. Практические рекомендации Какие предметы выбирают выпускники для сдачи экзамена

Школа — прекрасное время в жизни подростка. Но рано или поздно этот этап пройден. Это касается будущих выпускников.

Многие дети решают бросить школу после 9 класса и начать учиться в специальном колледже. Но какие предметы легче изучать в 9 классе? Как определить будущую специальность? На что ориентироваться на тренировках и как правильно подготовиться к ГИА? Разберемся пошагово.

Выбор направления

Решиться на сдачу экзаменов необходимо уже в начале 9 класса. Чтобы правильно спланировать свое обучение, сначала необходимо выбрать направление будущего обучения — техническое или гуманитарное. Какой из них проще?

Здесь следует отметить, что все зависит от задатков самого ученика. Кому-то с начальной школой и до самого конца обучения математике и другим точным наукам легче учиться, а кому-то больше нравится изучать историю и географию, поэтому ответ на вопрос «какие предметы легче всего брать в 9 классе» будет для всех разным.Принять решение довольно просто, если руководствоваться этими принципами.

Поэтому, если вы изначально замечаете склонность к изучению какой-либо науки, которая вам больше нравится или дается легче, то ответьте на вопрос: «Какие предметы легче брать после 9 класса?» — Вам будет намного легче. Кроме того, нужно изучать специальности колледжей, которые могут включать в себя любимый предмет или аналогичное направление. Также следует ознакомиться со специальностями, которые можно получить в вузе.

Но как определить, какие предметы вам легче изучать в 9 классе? Вот несколько советов, которые помогут вашему ученику ответить на этот вопрос.

  1. Проведите самотестирование. После прохождения тестов на профориентацию у студента уже будет ориентир.
  2. Свяжитесь со специальными организациями, которые проводят профориентацию студентов. Специалисты помогут более точно определить направление ваших предрасположенностей и задатков.
  3. Оцените масштаб задачи.Если вы мечтаете стать айтишником, то решайте сами — сможете ли вы целый год (а затем и все школьные годы) глубоко изучать информатику и получить другие необходимые знания.

Обращаем ваше внимание, что даже если какой-либо предмет для вас не очень легкий, но необходимо получить ту профессию, которую вы выбрали, с большим трудом и трудом вы сможете ее освоить. Главное — приложить много усилий, уделить время самообучению, а иногда отказывать себе в прогулках с друзьями и других видах отдыха.

Какие предметы мне нужно изучать после 9 класса? Обязательными являются два предмета — математика и русский язык, остальные ученики выбирают по собственному желанию.

А теперь давайте разберемся, по каким предметам легче сдавать экзамены в 9 классе по каждому направлению.

Гуманитарная направленность

Если студент определил, что желает продолжить обучение по гуманитарному направлению, то одним из предметов для сдачи является обществознание. Нельзя сказать, что этот предмет очень легко пройти.Однако если у вас есть положительные оценки и вы регулярно готовите домашнее задание по этому предмету, то сдать его с хорошими отметками не составит труда. При самостоятельном изучении обществознания вы сможете добиться довольно высоких результатов.

Какие предметы мне нужно изучать после 9 класса по гуманитарным наукам? Их может быть несколько.

  • История.
  • География.
  • Литература.

Эти предметы непростые, однако чаще всего они входят в список обязательных для поступления в вуз.

В отдельную группу следует выделить биологию и химию. Эти предметы можно назвать сложными для сдачи, но их сложность связана со сложной специализацией. Даже будущие психологи сдают биологию, и оба предмета необходимы для поступления в медицинский колледж.

Техническая направленность

Какие экзамены по выбору лучше всего сдавать в 9 классе желающим получить технический диплом? Физика, конечно же, стоит на первом месте в этом списке. Этот предмет сложно назвать простым, однако вполне возможно сдать экзамен с хорошим баллом, если заниматься регулярными тренировками.

Следующий предмет — информатика. Это необходимо тем, кто хочет стать программистом и иметь профессию, связанную с информационными технологиями. Этот предмет, как и физику, нельзя назвать легким, но для ученика, хорошо ладящего с компьютерными технологиями, один из ответов на вопрос: «Какие предметы легче сдавать в 9 классе?» — Будет информатика.

Также не стоит забывать об одном из обязательных предметов — математике. Для поступления в технический вуз требуется 99% времени.Поскольку этот предмет является обязательным для сдачи GIA, к нему необходимо готовиться так же тщательно, как и к остальным выбранным предметам.

После того, как ученик ответил на вопрос: «Какие предметы легче всего сдавать в 9 классе?» — составить план подготовки к экзаменам. Что нужно сделать?

  1. Для начала следует составить расписание (и желательно письменное — это поможет вам более точно следовать плану), в котором вы будете выделять время на занятия.Помните об этом, чем больше предметов планирует изучать ученик, тем больше времени ему придется посвятить самостоятельному изучению. Чтобы хорошо сдать экзамены, вам необходимо уделять каждому предмету не менее 4 часов в неделю.
  2. Если есть возможность, занимайтесь дополнительно с репетиторами — это поможет не только сократить время на самоподготовку, но и даст больший результат, ведь занятия со специалистом всегда лучше, чем самостоятельные. К тому же самоподготовка требует большой силы воли, поэтому не исключено, что ее результаты иногда будут на довольно слабом уровне.С репетитором этого не случится.
  3. При работе использовать кодификаторы. Другими словами, кодификатор — это документ, который отражает принцип составления KIM, а также включает все темы, используемые для составления тестов для GIA. Это означает, что вы изначально сможете знать все темы вашего предмета, вопросы и задачи, по которым можно встретиться в тестах.

Не забывайте про перерывы

И, конечно, не забывайте об отдыхе, которому тоже нужно уделить время.

Выделите дни, когда вы не будете тренироваться. Например, это может быть 1-2 дня в неделю. Кроме того, организму необходим ежедневный отдых, а лучше всего — час прогулки на свежем воздухе.

Иногда бывают моменты, когда кажется, что силы иссякли, и изучаемому предмету это надоело до ужаса. Позвольте себе неделю отдыха без занятий, но не часто такие перерывы.

Результат

Надеемся, что теперь вы полностью получили ответ на вопрос: «Какие предметы легче сдавать в 9 классе?» Не забывайте хороший фразеологизм — «тяжело в обучении, легко в бою».«Любой предмет может стать легким, если к нему тщательно подготовиться, и тогда ГИА не будет казаться таким сложным, как в начале подготовки.

Все студенты сдают итоговую государственную аттестацию, то есть сдают экзамены. Всего ученикам предстоит сдать не менее 4 экзаменов, среди которых обязательные по математике и русскому языку, а остальное ученик выбирает самостоятельно из всего списка предметов, которые он изучает в школе. Среди этих предметов вы можете выбрать экзамен, географию, историю, иностранные языки (английский, немецкий и французский), физику, химию, биологию, информатику и информационные технологии.

Кроме того, все учащиеся после 9 класса обязаны сдавать математику и русский язык в формате GIA — итоговые тесты и задания, которые проводятся как единый экзамен для всех российских школьников. Как сдавать остальные предметы ученик решает сам: вы можете выбрать GIA или сдать экзамен в своей школе в обычном виде, например, по билетам или в виде письменного экзамена, проекта и т. Д. на.

Иногда школа сама поощряет своих учеников сдавать GIA по другим предметам или объясняет, что им это не нужно.Выбор GIA по другим предметам также зависит от того, останется ли ученик в школе после 9 класса. Если нет, то результаты GIA могут понадобиться ему для поступления в колледж или школу. В этом случае нужно выбрать те предметы, которые являются профильными в данных учебных заведениях. При переводе в другую школу также иногда требуются результаты GIA по всем четырем предметам.

Иногда школы определенного профиля могут назначить учащимся дополнительный экзамен, тогда учащиеся должны сдать три обязательных предмета и два или один факультативный.Общее количество экзаменов для учеников 9 класса не должно превышать пяти.

примечание

Подать заявку на сдачу экзаменов в форме GIA и указать количество этих экзаменов необходимо до 1 марта текущего года. Позже будет невозможно внести изменения в приложение.

Победители Всероссийских олимпиад освобождаются от сдачи экзамена по предмету олимпиады.

Если ученик не сдает хотя бы один из обязательных предметов, ему не выдается аттестат о 9 классе.Однако он может попытать счастья во второй раз в том же году и пересдать экзамен через несколько дней. Если и эта попытка не удалась, такому ученику может быть выдан только свидетельство об окончании 9 класса. Такого ученика ни в 10 класс, ни в колледж не возьмут. У него будет два выбора — либо остаться в школе на второй год и снова пройти программу 9-го класса, либо покинуть учебное заведение, подготовиться самостоятельно и пересдать экзамены в следующем году.

Рано или поздно в жизни каждого студента наступает момент, когда нужно начинать подготовку к экзаменам.А самый первый серьезный экзамен в нашей стране ждет учеников уже в 9 классе. ОГЭ — общегосударственный экзамен, представляет собой тест на определение уровня знаний студента по каждому предмету.

Также результат, полученный в ОГЭ (9 балл) влияет на оценку в аттестате, поэтому очень важно хорошо пройти аттестацию.

Но не каждый школьник в начале года понимает, какие предметы легче брать в ОГЭ, а каким лучше отдавать предпочтение.Разберемся пошагово.

Классификация всех предметов

Прежде всего, каждый студент должен знать, что все предметы условно можно разделить на две группы: гуманитарные и технические.

Есть довольно много предметов, которые относятся к категории технических. Однако именно эти науки в 90% случаев необходимы для поступления в технический вуз. Среди них математика, физика, информатика. Следует отметить, что физика — единственный предмет, который в 99% случаев сдается при поступлении на техническую специальность.Информатика также является распространенным выбором для сдачи экзамена, но она необходима для получения профессий, связанных с программированием.

В список вошли еще многие школьные предметы. Среди них:

  • истории;
  • Общественные науки;
  • литературы;
  • география;
  • биология;
  • химия;

Хотя, конечно, биология и химия часто выделяют в отдельную группу, их принято относить к списку гуманитарных дисциплин, которые передаются в ОГЭ.

И не стоит забывать об обязательных предметах для сдачи ОГЭ. Их всего два: русский и математический. Поэтому какое бы направление вы ни выбрали, необходимо помнить, что подготовка к этим предметам является обязательной для успешной сдачи ОГЭ.

9 класс — тяжелый период. В этом году каждый должен определиться с предметами, которые он хочет изучать. Но какие предметы легче взять на ОГЭ?

Выбор направлений

Чтобы сделать выбор, вы должны сначала подумать, какие науки вам легче всего.Ведь не секрет, что одни прекрасно разбираются в физике, другие умеют решать сложные задачи по химии, а третьи хорошо разбираются в истории.

Следовательно, ученик должен понимать, что не существует списка легких предметов, потому что они у всех разные.

Чтобы понять, какие предметы вам легче брать на ОГЭ, вам следует сначала выбрать одно из двух направлений. Определившись, можно переходить к дальнейшим поискам.

Выбор технического направления

Если выбор пал на техническое направление, то, скорее всего, физика не является невыносимой наукой для школьника.Но, увы, это не всегда так. Иногда желание получить техническую специальность может не сбыться из-за проблем с необходимыми для сдачи предметами. Что делать в этом случае?

Если вы понимаете, что физика — не самый легкий предмет, то вам нужно правильно спланировать свое обучение.

  1. Обратитесь за помощью к репетитору. Если студенту необходимо набрать достаточно большое количество баллов, то самостоятельно качественно подготовиться к ОГЭ очень сложно.
  2. Помимо занятий со специалистом, ребенок должен заниматься самостоятельно, а это значит планировать свою работу и четко следовать расписанию занятий.
  3. Для успешной сдачи экзамена по физике требуется много практики. Постоянное решение проблем — залог успеха в НГЭ.

Тот же совет применим и к другим точным наукам, таким как математика и информатика.

Гуманитарное направление

С гуманитарным направлением все немного иначе.Конечно, из-за большого количества предметов каждый сможет найти для себя самый простой. Но мы можем предложить список самых популярных предметов для сдачи экзамена, что говорит о том, что они относительно простые.

Социальные науки

Этот предмет изучают около 70% учеников 9 класса. Такая высокая популярность объясняется тем, что предмет легче понять и запомнить. Эта наука не точна, и много знаний по этому курсу студент получает в процессе жизни, потому что этим предметом является наука об обществе.

Но не стоит забывать, что световых объектов на ОГЭ не будет, если не заниматься их подготовкой. Студент, который регулярно выполняет домашние задания по обществознанию, самостоятельно готовится дома хотя бы пару раз в неделю и интересуется предметом в классе, несомненно, получит высокий балл в ОГЭ.

История

Вообще-то назвать этот предмет легким язычком сложно. Но около 28% учеников 9-х классов сдают историю. В чем секрет? Дело в том, что история — это наука, которую нужно преподавать и запоминать.Здесь нет сложных задач и формул, но есть большое количество дат и событий, которые нужно запомнить. Если за подготовку отвечает ребенок, то кроме тщательного запоминания ему ничего не понадобится. А значит, экзамен для него не будет таким сложным.

Биология

И завершает этот список биология. Биология — очень интересная наука. К тому же она необходима для поступления в любой медицинский вуз, без нее немыслимо получить медицинское образование.Поэтому этот предмет часто выбирают в 9 классе. Но не слишком легкий. В заданиях ОГЭ ребенку могут встретиться не только тестовые вопросы, но и задачи, которые необходимо решить. Хорошо то, что биологию понять нетрудно. Приложив все усилия, эту тему можно будет пройти.

Вот и все. Студенту остается хорошенько подумать о своих предпочтениях и способностях, и он сможет ответить для себя на вопрос, какие предметы легче взять на ОГЭ.Если он планирует свои тренировки, ОГЭ перестанет казаться ему таким страшным и сложным.

Также студент должен знать, сколько предметов брать на ОГЭ. Изменения, произошедшие за пару лет, вряд ли порадуют будущих студентов. И заключаются они в том, что если раньше ученик мог сдавать только обязательные предметы или выбирать те, которые ему нужны, то сегодня, помимо двух обязательных предметов, каждый должен определить еще два предмета, которые он хочет сдать.

Это означает, что каждый студент должен подготовиться как минимум по 4 предметам или даже больше. Но и этого опасаться не стоит. Не забывайте, что если вы отвечаете за обучение, то вам не придется думать, какие предметы легче взять на ОГЭ.

Привет дорогой. В этой статье я хотел бы рассказать о том, какие экзамены сдают в 11 классе и о ЕГЭ 2018, который скоро придется сдавать всем выпускникам школ. И не нужно думать, что статья получится огромной и лучше разбить ее на 2 статьи, не лучше.Если вам не нужно читать о том, какие экзамены сдают в 11 классе, но интересно прочитать о ЕГЭ 2018 или ЕГЭ 2019, просто прокрутите вниз до подпункта, который называется так.

Но я начну с того, какие экзамены сдавать, как выбирать, сколько сдавать и так далее.

Выбирайте, готовьтесь, подходите к вопросу осознанно и внимательно

Если вы ответите строго на поставленный в подпункте вопрос, то отвечу, с 2017 года они должны сдать русский язык, математику и еще 1 предмет по своему выбору.Причем математику можно сдавать на профильном уровне, а можно брать базовый. В случае успешной сдачи экзамена вы в любом случае получите сертификат, но не все университеты могут заниматься базовой математикой.

Если немного отклониться от темы, то нужно подумать о том, что вы сдаете ЕГЭ 2018, как и ЕГЭ других лет, не ради получения сертификата, а для того, чтобы иметь возможность продолжить учеба и выберите университет. Если ты не хочешь учиться дальше, но хочешь работать грузчиком или продавщицей в ларьке, который не снесут ни сегодня, ни завтра, то, конечно, не нужно много думать об этом.Если вы не планируете никуда поступать, то сдайте следующие экзамены:

  1. Русский язык.
  2. Основы математики.
  3. Самая легкая для вас тема. Что это за предмет понятия не имею, думайте сами и выбирайте.

Но этот вариант мало кому интересен, поэтому нужно мыслить шире. Начните с какого класса вы учитесь — гуманитарного или технического? Это очень важный момент, потому что если вы выдерживаете 8 часов в неделю по математике и 6 по информатике или физике, и это не вызывает у вас явного отторжения, то вы явно технарь и вам нужно поступать на техническую специальность.То же самое и с гуманитарными науками.

Хуже, если ты учишься в техническом классе, а математику тихонько ненавидишь, а русский с литературой учишь с удовольствием. В этом случае что-то явно пошло не так, и вам следует перейти в гуманитарный класс. Опять же, верно и обратное. И не стоит откладывать это и думать: «Ой, ладно, я собираюсь поступать на инженера и учиться здесь». Очень важно понимать, технарь ты или гуманитарий, потому что для технаря учиться на гуманитарии в университете — просто жуткая мука.Ученым-гуманитариям проще, их отчисляют после первой сессии и все. Не потому, что они не могут учиться, может быть, могут, но они не хотят.

Ладно, это все лирика, вернемся к вопросу о том, какие экзамены сдают в 11 классе. Опять же, экзамены стоит сдавать те, которые нужны для поступления. Если вы, например, хотите учиться на программиста, лучше об этом забыть, тогда логично, что помимо обязательных предметов нужно сдать информатику.Но не будьте излишне самоуверенным человеком, есть несколько моментов, которые могут положить конец вашему желанию изучать программирование:

  1. Вы можете не сдать информатику и ИКТ с достаточной оценкой для поступления. Вы, конечно, можете быть лучшим программистом в классе, но легко сдать информатику за какие-то злополучные 50 баллов и безопасно летать с допуском.
  2. Кто-то может уговорить вас поступить на другую специальность. И это может произойти, например, в апреле, когда уже ничего нельзя исправить.
  3. Вы можете посетить университет, где преподают программирование, и посмотреть, кто там учится. Красивых людей туда просто не берут или, если попали по ошибке, быстро выгоняют. Сам учился в IT-университете, поэтому знаю, о чем говорю :(.

Это относится к конкретному примеру, но первые 2 пункта универсальны и будут работать везде. Во избежание этого нужно сдавать на ЕГЭ 2018 не 3 предмета, а больше. Если вы технарь, вы должны знать и физику, так что сдавайте ее.Но физика — очень сложный предмет и поэтому стоит задуматься, а что сдавать такому гуманному? На мой взгляд, самый полезный и простой доступный предмет — это обществознание. Лично для меня это просто, но я вполне могу оправдать его полезность. На протяжении многих лет обществознание является предметом, позволяющим поступать на самые разные специальности, причем не всегда строго гуманитарные. Если вы не любите обществознание, то подумайте сами, что будете сдавать экзамен. Может быть, география, может быть, химия, как мне узнать, что вам ближе?

Главное помнить, что не стоит брать 3 предмета, лучше перестраховаться и сдать 4-5, при этом готовиться к университету, где столько экзаменов придется сдавать каждый семестр .

Я чувствую, что гуманитарные науки обижаются, потому что я мало о них пишу, но зачем переписывать то же самое здесь, превращая информатику в социологию, а социальные науки на биологию? Я здесь не призываю всех сдавать какие-то вещи в унисон, я просто даю материал для размышлений. И вообще, по гуманитарным наукам я уже писал об этом статью, тоже будет полезно прочитать.

ЕГЭ 2018, что еще скажешь …

Все, с абзацем, какие экзамены сдают в 11 классе, закончили, теперь поговорим о ЕГЭ 2018.

Начну с хороших новостей: экзамены по математике, истории и биологии не изменились. То есть количество заданий, уровень сложности, все осталось на том же уровне, что и раньше. В остальном экзамены изменились, но вроде бы не столь критично, сейчас перечислю все изменения, которые я нашел в списке:

  1. английский. Изменения вроде бы даже положительные, так как сейчас не должно быть споров, правильно это или нет, все должно быть строго описано.
  2. Общественные науки. Как самый популярный предмет, в ЕГЭ 2018 он … практически не претерпел изменений. Только задачи с развернутым ответом стали цениться больше, соответственно, остальные немного меньше, и теперь нужно немного иначе, в соответствии с новыми требованиями, привыкать писать развернутые ответы.
  3. Литература. Говорят, что изменения в ЕГЭ-2018 очень серьезные. Я не могу переписать все эти изменения своими словами, поэтому все, кто хочет взять литературу, обращаются к другим источникам.
  4. Русский язык. Добавлено целое одно задание, которое проверяет ваше знание лексических норм, а не только правил русского языка. Но не спешите радоваться, остальные задачи тоже должны усложниться.
  5. Физика. Добавлены интересные задания, которые сделают экзамен еще интереснее. Тем не менее, я украду пару предложений с другого сайта, чтобы показать вам всю глубину глубины: «Теперь на Едином государственном экзамене по физике в 2018 году вы можете встретить такие темы, как« Эффективность увлажнения », основы СТО,« Закон » сохранения электрического заряда »,« Конденсатор ».Будьте внимательны, ведь они еще не вошли в большинство учебных пособий, а без этого получить желаемый балл просто невозможно. «© Мел.
  6. Химия. Добавлена ​​новая задача, изменена одна старая. Нет ничего критичного.

Итак, вроде все.

В заключение хочу сказать, что экзамен — это совсем не то, чего стоит бояться, нужно просто подготовиться к этому экзамену и все будет хорошо. И не забудьте на всякий случай выбрать больше экзаменов.

update прошлогодняя статья

Не так давно Денис попросил расширить статью и добавить информацию о том, что ждет в 2019 году. Я обещал это сделать, а лучше обещания сдержать, поэтому сейчас напишу про Unified Государственный экзамен 2019.

Но потом выяснилось, что о нем уже была статья, вы можете ознакомиться с ней, перейдя по ссылке. Но, поскольку я вместо того, чтобы просто дать ссылку на статью, пообещал расширить эту статью, мне придется украсть у себя и передать суть статьи сюда, оставив воду в полноценной статье.

Итак, на официальном сайте появилась информация, что экзамен будет проходить в 3 этапа и обозначились даты этих этапов, предлагаю вам ознакомиться с ними:

  • Ранний этап — с 20 марта по 10 апреля, 2019 г.,
  • Основной этап — с 27 мая по 1 июля 2019 г.
  • Дополнительный этап — с 3 по 20 сентября 2019 г.

Теперь вы можете перейти к вопросу о том, что нового будет на экзамене в 2019 году. Нового не будет много, но есть моменты, на которые стоит обратить внимание:

Момент количества раз — это невозможность одновременного прохождения математики как базового, так и профильного уровня.Как оказалось, школьники очень любили сдавать математику на обоих уровнях, чтобы иметь хоть какой-то результат и получить аттестат. И даже поступить, но не по всем специальностям. Теперь вам нужно будет выбрать то, что вам нужно, быть лучшим гуманистом, не знающим математики, физики и информатики, или стать правильным человеком с высшим техническим образованием 😆

Ладно, это все шутки, гуманитарные науки тоже необходимо обществу, наверное … Итак, теперь серьезно.В случае, если вы не можете сдать математику профильного уровня, вы сможете пересдать на том же ЕГЭ 2019 и там уже сможете выбрать математику базового уровня.

Мы переходим от математики к информатике и ИКТ. Если раньше при сдаче экзамена по информатике использовали ручку и лист бумаги, то теперь этот экзамен можно будет сдавать на ПК. Что, на мой взгляд, правильно и логично.

И последняя новость, которая на этот раз не касается людей с техническим складом ума.Теперь можно будет выбрать другой иностранный язык для сдачи экзамена … Помимо традиционных — английского, французского и немецкого языков, впервые можно будет выбрать китайский язык. Я полностью поддерживаю эту инициативу. В конце концов, именно Китай имеет самое большое население на планете и граничит с Россией.

В общем, я все написал об изменениях в экзамене, которые будут в 2019 году. Если вы хотите узнать об ответах на экзамен 2019, перейдите по ссылке, которая была в начале статьи, и прочтите.

Когда девятиклассник стоит перед выбором предметов для сдачи в ОГЭ, возникает вопрос — по каким предметам будет легче подготовиться?

В 2017 году нужно сдать 4 предмета, а в 2018 — уже 5. Из них русский язык и математика обязательны, т.е. в любом случае вам придется усилить подготовку к ним. Далее, выбор предметов зависит от того, хотите ли вы остаться в школе или поступить в институт?

Если вы хотите продолжить учебу в престижном колледже, то вам стоит пойти на День открытых дверей и узнать, какие предметы и какие результаты нужны для поступления.В этом случае у вас мало выбора — вам придется подготовить необходимые предметы. Если вы решили остаться в 10-11 классах, вам стоит подумать, в какой вуз вы пойдете после 11 класса, выбрать нужные предметы и уже с 9 начать готовиться и попробовать свои силы в ОГЭ. Это, конечно, идеал.

Что делать, если вы еще не выбрали, кем быть? Что, если вы просто хотите окончить школу, а потом что будет? В этом случае нужно выбирать более легкие предметы.

Сразу хотим предупредить, что все школьные предметы достаточно сложные. А понятие «легкость» ОГЭ в любой тематике весьма условно. Кто-то может подумать, что ОГЭ по информатике — легкий экзамен, но кому-то ОГЭ по химии. Здесь можно дать одну рекомендацию. Выберите предметы, по которым у вас есть сильный учитель в школе. Вам будет казаться, что очень сложно подготовиться, что учитель требует от вас многого, что он очень строгий и т. Д., но это цена успешной сдачи экзамена.

Обзор позиции

Общественные науки

Почему-то многие ребята выбирают эту тему и считают ее легкой. Это совсем не так. Объем материала большой, заданий много — есть и тестовая часть, и вопросы, на которые нужно ответить письменно, а также задание с развернутым ответом. В целом ОГЭ по обществознанию сложно назвать простым.

Химия

Традиционно эту тему мало кто выбирает.Сами учителя создали миф о том, что химия — это очень сложно. Но мы так не думаем. В основном ОГЭ проверяет знания по неорганической химии и основам органики. Если готовиться на совесть, то ОГЭ можно сдать без проблем и на хорошую оценку.

Литература

Многие думают: «Ну, этот предмет очень легко пройти». Мы хотим вас огорчить, это одно из самых объемных и сложных в исполнении предметов.Тестов по ОГЭ в литературе нет. Вы должны выполнить 4 задания — 3 мини-эссе и 1 большое полное эссе. То есть во время подготовки нужно будет много читать и много практиковаться в написании рефератов.

Информатика

Многие могут ошибочно полагать, что если у вас хорошие навыки работы с компьютером, это поможет вам сдать ОГЭ по информатике. Отнюдь не. Для сдачи ОГЭ по информатике необходимо в школьной программе хорошо знать языки программирования, алгоритмы, блок-схемы, логику, математику и т. Д.На ОГЭ по информатике тоже есть задачи, теоретические вопросы и т. Д. Сдать этот экзамен на высокий балл достаточно сложно.

География

Этот предмет заслуживает особого внимания. Многие считают его незначительным и ненужным, в то время как предмет очень важен и знания по нему требуются во многих местах. Однако сам экзамен не из легких. Вы должны уметь пользоваться картами, строить азимуты, разбираться в розах ветров, читать специальные карты, знать экономику и т. Д.Подготовка к этому экзамену сложная, но очень интересная.

Физика

Экзамен сложный. Обилие заданий, теоретические вопросы, прикладные задания, а также лабораторные работы затрудняют подготовку к этому экзамену. Недостаточно знать предмет, нужно еще знать математику, считать в уме, мыслить логически и т. Д. Оценки по этому предмету традиционно низкие по всей стране.

Биология

Этот предмет нужен тем, кто собирается поступать в медицинские вузы и колледжи.ОГЭ по биологии мало чем отличается от экзамена. Объем большой, задач много, есть даже задачи. Сложно пройти за высокий балл.

Иностранный язык

Этот предмет стоит выбирать тем, кто давно его изучает, общается в сетях на иностранном языке, кто-то говорит дома на иностранном языке. Экзамен обычно проходит в два этапа — устный и письменный. Пройти его сложно, особенно оральную часть.Но письменная сторона тоже сложна.

История

Даты, личности, события — все о НГЭ в истории. Предмет сложный, а экзамен тем более. Большой объем информации, сложные задания делают этот предмет самым непопулярным. Сдать сложно, приготовить тоже.

В итоге можно с полной уверенностью сказать, что ОГЭ по любому предмету будет непросто. Без подготовки к экзаменам сложно обойтись, потому что велика вероятность, что вы просто не сдадите.К каждому предмету нужно готовиться, подготовка должна быть ежедневной.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *