Миэф 1 курс расписание: Расписание занятий – Международный институт экономики и финансов – Национальный исследовательский университет «Высшая школа экономики»

Содержание

расписание занятий высшая школа экономики

Расписание занятий и. Высшая школа экономики, 2017. no. wp brp 45/ps/2017 . Все публикации Расписание занятий и сессий БАКАЛАВРИАТ. НИУ «Высшая школа экономики. университет «Высшая школа экономики» → Лицей НИУ ВШЭ → Расписание занятий. О. Национальный исследовательский университет «Высшая школа экономики. экономики» → Аспирантура → Аспирантская школа по экономике → … Расписание занятий;. Третий год Высшая школа экономики проводит конкурс поддержки студенческих инициатив, которые делают университет … Расписание занятий; Стоимость и оплата. Национальный исследовательский университет «Высшая школа экономики. Расписание занятий. Это расписание действует. Национальный исследовательский университет «Высшая школа экономики. Национальный исследовательский университет «Высшая школа экономики. интегрированных коммуникаций → Школа коммуникаций для юных → … НИУ «Высшая школа экономики. Расписание занятий. Это расписание действует. Национальный исследовательский университет «Высшая школа экономики. программа "Управление и экономика здравоохранения" → Расписание занятий. Расписание занятий на период с 09.01.2017 по 30.04.2017. 1 год обучения (прием 2016 года). Национальный исследовательский университет «Высшая школа … Расписание занятий аспирантов 2-го года обучения (2015 г.п.). Национальный исследовательский университет «Высшая школа экономики. Национальный исследовательский университет «Высшая школа экономики. Расписание занятий (история и философия науки, иностранный язык) … Национальный исследовательский университет «Высшая школа экономики. Расписание занятий. Расписание занятий на 2. Национальный исследовательский университет «Высшая школа экономики. Расписание занятий. Аспирантская школа по политическим. Аспирантская школа по менеджменту и. Расписание занятий по военной. → Образовательные программы бакалавриата → Санкт-Петербургская школа экономики и. Расписание занятий. Это расписание действует. Национальный исследовательский университет «Высшая школа экономики. Весной 2017 года действует следующее расписание занятий. Начало занятий … « ВЫСШАЯ ШКОЛА ЭКОНОМИКИ » БАНКОВСКИЙ. РАСПИСАНИЕ ЗАНЯТИЙ слушателей дополнительной профессиональной образовательной. занятий 09. НИУ «Высшая школа экономики» ru; en; Найти. Расписание занятий Расписание экзаменационной. Расписание занятий по группам смотрите на страницах программ «11 класс», «10-11 класс», «9 класс».. Национальный исследовательский университет … Высшая школа экономики. Национальный исследовательский. Национальный исследовательский университет «Высшая школа экономики. » → Международный институт экономики и финансов → ICEF Evening School → … Расписание занятий, контрольных мероприятий и пересдач. НИУ «Высшая школа экономики» ru; en; Найти. Расписание занятий. Национальный исследовательский университет «Высшая школа экономики. Национальный исследовательский университет «Высшая школа экономики. оптимизирующие расписание занятий. Для инициирования изменений в … Расписание занятий; Стоимость и оплата. Национальный исследовательский университет «Высшая школа экономики. НИУ «Высшая школа экономики. → Институт налогового менеджмента и экономики недвижимости → Расписание занятий. Институт налогового … Миэм ниу вшэ расписание занятий. Категории :. высшая школа экономики расписание занятий. Рамках конкурса студенты дки миэм ниу программа … ... Новгороде → Образовательные программы магистратуры → Факультет экономики НИУ ВШЭ (Нижний Новгород) → Магистерская программа …... (Нижний Новгород) → Расписание занятий. Довузовская подготовка (Нижний Новгород) Школа информационных технологий и математики (Нижний Новгород) … Law. LAW. Высшая школа экономики, 2016. No. 2.. Список свободных аудиторий для самостоятельных занятий находится на доске. Расписание занятий на 4 … Расписание занятий в спортивных. Национальный исследовательский университет «Высшая школа экономики. Национальный исследовательский университет «Высшая школа экономики. Расписание занятий в. ... → Расписание. Магистерская программа «Интеллектуальный анализ. Расписание занятий. Это расписание действует. Расписание занятий в ШБМ на 2015-2016 учебный год:. Национальный исследовательский университет «Высшая школа экономики. Национальный исследовательский университет «Высшая школа экономики. Расписание занятий. Расписание сессии 1 бак с 22 по 31.

Международный институт экономики и финансов НИУ ВШЭ

Я б в нефтяники пошел!

Пройди тест, узнай свою будущую профессию и как её получить.

Химия и биотехнологии в РТУ МИРЭА

120 лет опыта подготовки

Международный колледж искусств и коммуникаций

МКИК — современный колледж

Английский язык

Совместно с экспертами Wall Street English мы решили рассказать об английском языке так, чтобы его захотелось выучить.

15 правил безопасного поведения в интернете

Простые, но важные правила безопасного поведения в Сети.

Олимпиады для школьников

Перечень, календарь, уровни, льготы.

Первый экономический

Рассказываем о том, чем живёт и как устроен РЭУ имени Г.В. Плеханова.

Билет в Голландию

Участвуй в конкурсе и выиграй поездку в Голландию на обучение в одной из летних школ Университета Радбауд.

Цифровые герои

Они создают интернет-сервисы, социальные сети, игры и приложения, которыми ежедневно пользуются миллионы людей во всём мире.

Работа будущего

Как новые технологии, научные открытия и инновации изменят ландшафт на рынке труда в ближайшие 20-30 лет

Профессии мечты

Совместно с центром онлайн-обучения Фоксфорд мы решили узнать у школьников, кем они мечтают стать и куда планируют поступать.

Экономическое образование

О том, что собой представляет современная экономика, и какие карьерные перспективы открываются перед будущими экономистами.

Гуманитарная сфера

Разговариваем с экспертами о важности гуманитарного образования и областях его применения на практике.

Молодые инженеры

Инженерные специальности становятся всё более востребованными и перспективными.

Табель о рангах

Что такое гражданская служба, кто такие госслужащие и какое образование является хорошим стартом для будущих чиновников.

Карьера в нефтехимии

Нефтехимия — это инновации, реальное производство продукции, которая есть в каждом доме.

Расписание

№ п/п

Наименование программы

Уровень образования

Форма обучения

Курс обучения

1

Правоведение

Профессиональная переподготовка

очная

1 курс

2

Правоведение

Профессиональная переподготовка

очно-заочная

1 курс

3

Фундаментальная социология

Профессиональная переподготовка

очная

1 курс
2 курс

4

Фундаментальная социология

Профессиональная переподготовка

очно-заочная

1 курс
2 курс


5

Практическая психология

Профессиональная переподготовка

очная

1 курс

6

Практическая психология

Профессиональная переподготовка

очно-заочная

1 курс

7

Психология принятия решений в управленческой деятельности (образовательный проект, совместно с РАНХиГС)

Профессиональная переподготовка

очная

1 курс

8

Менеджмент в сфере культуры

Профессиональная переподготовка

очная

1 курс

9

Менеджмент в сфере культуры

Профессиональная переподготовка

очно-заочная

1 курс

10

Медиаменеджмент (образовательный проект, совместно с РАНХиГС)

Профессиональная переподготовка

очная

1 курс

11

Политическая философия

Профессиональная переподготовка

очная

1 курс

2 курс

12

Политическая философия (образовательный проект, совместно с РАНХиГС)

Профессиональная переподготовка

очная

1 курс

2 курс

13

Политическая философия

Профессиональная переподготовка

очно-заочная

1 курс

2 курс

14

Международная политика

Профессиональная переподготовка

очно-заочная

1 курс

15

Историческое знание в современном обществе

Профессиональная переподготовка

очная

1 курс

16

Историческое знание в современном обществе

Профессиональная переподготовка

очно-заочная

1 курс

2 курс

Академический календарь | Вашингтон, округ Колумбия,

Вторник, 1 июня - воскресенье, 25 июля 2021 года

Летние программы в Вашингтоне, округ Колумбия

Понедельник, 5 июля 2021 г.

Встречается День независимости - SAIS закрыт

Понедельник, 5 июля - вторник, 24 августа

Предварительная программа

Понедельник, 12 июля - пятница, 20 августа 2021 г.

ММЭФ Летний семестр для когорты 2021-2022 гг.

Понедельник, 23 августа - пятница, 27 августа 2021 года

Предварительный / учебный курс MASIS

Пятница, 27 августа 2021 г.

Дата присвоения летнего образования

Суббота, 28 августа 2021 г.

Начало осеннего семестра 2021 года

Понедельник, 6 сентября 2021 г.

День труда - SAIS закрыт

Воскресенье, 21 ноября - воскресенье, 28 ноября

2021

Осенние каникулы / Неделя благодарения

Понедельник, 6 декабря 2021 г.

Осенью 2021 г. окончание занятий

Пятница, 31 декабря 2021 г.

Дата присвоения диплома о понижении

Понедельник, 10 января - пятница, 21 января 2022 года

Межсессионные МИЭФ и МАСИС

Суббота, 22 января 2022 г.

Начало весеннего семестра 2022 года

Суббота, 30 апреля 2022 г.

Весна 2022 г. окончание занятий

Среда, 25 мая 2022 г.

Выпускной вечер SAIS

Четверг, 26 мая 2022 г.

Церемония выпуска JHU в Балтиморе и

дата получения весеннего диплома

Понедельник, 30 мая - понедельник, 27 июня 2022 г.

Летний семестр ММЭФ для студентов 2021-2022 гг. Когорта

Вторник, 31 мая - воскресенье, 24 июля 2022 г.

Летние программы в Вашингтоне, округ Колумбия

Понедельник, 4 июля 2022 г.

День Независимости - ГАИС закрыт

Понедельник, 11 июля - пятница, 19 августа 2022 года

ММЭФ Летний семестр на 2022-2023 гг. Когорта

Пятница, 26 августа 2022 г.

Дата присвоения летнего образования

Потеря MIEF1 / MiD51 придает восприимчивость к BAX-опосредованной гибели клеток и PINK1-PRKN-зависимой митофагии

РЕФЕРАТ

Митохондриальная динамика в значительной степени вовлечена во множество клеточных процессов, включая апоптоз и митофагию.Однако мало что известно о масштабах и точных функциях белков митохондриальной динамики для контроля качества митохондрий и клеточного гомеостаза. Служат ли белки митохондриальной динамики в клеточных процессах, основанных на делении-слиянии митохондрий, до сих пор полностью не исследованы. MIEF1 / MiD51 (фактор элонгации митохондрий 1), как известно, способствует делению митохондрий за счет рекрутирования белка GTPase DNM1L / DRP1 (подобного динамину 1), но фундаментальное понимание MIEF1 для митохондриально-зависимых клеточных процессов в значительной степени неуловимо.Здесь мы сообщаем о новой роли MIEF1 в ответе на апоптотические стимулы и повреждение митохондрий. Учитывая наш результат, что лечение стауроспорином (STS) индуцировало деградацию MIEF1 через убиквитин-протеасомную систему (UPS), мы заинтересованы в изучении роли MIEF1 в апоптозе. Потеря MIEF1 вызвала дисбаланс членов семейства BCL2 в митохондриях, в результате чего инициировалась транслокация BAX в митохондрии, катализируя снижение потенциала митохондриальной мембраны и способствуя высвобождению DIABLO / SMAC (диабло-IAP-связывающий митохондриальный белок) и CYCS (цитохром в, соматический).Мы также демонстрируем, что дефицит MIEF1 нарушает митохондриальное дыхание и индуцирует митохондриальный окислительный стресс, повышая чувствительность клеток к PINK1-PRKN-опосредованной митофагии. Рекрутирование PRKN в деполяризованные митохондрии модулирует зависимую от UPS деградацию MFN2 (митофузин 2) и FIS1 (деление, митохондрия 1), в частности, для дальнейшего стимулирования митофагии. Наши находки раскрывают связующую роль MIEF1 в интеграции клеточной гибели и митофагии, маловероятно зависящей от митохондриальной динамики, что предполагает новое понимание механизмов, определяющих клеточную судьбу.

Сокращения : ActD: актиномицин D; BAX: BCL2-ассоциированный X, регулятор апоптоза; BAK1: антагонист / убийца BCL2 1; BCL2L1: BCL2, как 1; BMH: 1,6-бисмалеимидогексан; CCCP: карбонилцианид 3-хлорфенилгидразон; CHX: циклогексимид; CQ: хлорохин; CYCS: цитохром с, соматический; DIABLO: диабло-IAP-связывающий митохондриальный белок; ДКО: двойной нокаут; DNM1L / DRP1: динамин 1 нравится; FIS1: деление, митохондриальная 1; GFP: зеленый флуоресцентный белок; IP: иммунопреципитация; MFN1: митофузин 1; MFN2: митофузин 2; MG132: карбобензокси-Лей-Лей-лейцинал; MIEF1 / MiD51: фактор элонгации митохондрий 1; MIEF2 / MiD49: фактор элонгации митохондрий 2; MOMP: проницаемость внешней мембраны митохондрий; MTR: MitoTracker Red; ОА: олигомицин плюс антимицин А; OCR: скорость потребления кислорода; OMM: внешняя митохондриальная мембрана; PARP: поли (АДФ-рибоза) полимераза; PI: иодид пропидия; PINK1: киназа 1, индуцированная PTEN; PRKN: убиквитин-протеинлигаза parkin RBR E3; ROS: активные формы кислорода; SD: стандартное отклонение; СТС: стауроспорин; TNF: фактор некроза опухоли; UPS: убиквитин-протеасомная система; VDAC1: канал анионов, зависящий от напряжения 1.

КЛЮЧЕВЫЕ СЛОВА: Апоптоз, BAX, MIEF1, митохондрии, митофагия

Введение

Адаптируясь к различным физиологическим требованиям, митохондрии сближаются и реагируют на поддержание клеточного гомеостаза [ 1 - 3 ]. Парадоксально, но митохондрии также важны в регуляции апоптотической гибели клеток [ 4 , 5 ]. Апоптоз - это генетически кодируемая программа самоубийства клеток [ 6 - 8 ], и нарушение регуляции апоптоза в значительной степени вовлечено в различные патологии, включая рак и нейродегенеративные заболевания [ 9 , 10 ].Баланс между проапоптотическими и антиапоптотическими белками семейства BCL2 управляет ключевым этапом в приверженности клеток апоптозу, регулируя проницаемость внешней мембраны митохондрий (MOMP) [ 4 , 11 , 12 ]. В ответ на апоптотические стимулы цитозольный BAX (BCL2-ассоциированный X, регулятор апоптоза) активируется, претерпевая структурную реформацию и гомоолигомеризуется на внешней митохондриальной мембране (OMM), в результате чего BAK1 (антагонист BCL2 / киллер 1) также самоолигомеризуется.Собранные комплексы митохондриальных BAX и BAK1 затем формируют поры на OMM, высвобождая белки межмембранного пространства, включая DIABLO (диабло IAP-связывающий митохондриальный белок) и CYCS (цитохром c, соматический) [ 13 , 14 ]. Ускользание DIABLO и CYCS из митохондрий в цитозоль активирует расположенные ниже каспазы, которые расщепляют ряд белков, что приводит к разрушению целой клетки во время апоптоза [ 15 , 16 ].

Митохондрии - это высокодинамичные органеллы, подвергающиеся непрерывному делению и слиянию [ 17 - 19 ].В соответствии с судьбой клеток, митохондриальная динамика тесно связана с апоптозом [ 20 , 21 ]. В частности, наиболее распространенным механизмом является то, что деление митохондрий ускоряет апоптоз, тогда как считается, что удлинение митохондрий защищает клетки от гибели. Накопленные данные указывают на то, что морфология митохондрий становится фрагментированной и что DNM1L, белок деления митохондрий GTPase, локализуется совместно с BAX и BAK1 в начале апоптоза [ 22 - 26 ].Однако остается неясным, как митохондриальная динамика регулирует MOMP. Некоторые исследования показали, что дисбаланс митохондриального деления-слияния из-за истощения DNM1L не мешает программированию апоптоза [ 27 - 30 ], что ставит под вопрос, является ли деление митохондрий предварительным для апоптоза. Таким образом, необходимо больше изучать характеристики белков митохондриальной динамики в регуляции гибели клеток.

Апоптоз, связанный с митохондриями, неизбежно приводит к большому образованию активных форм кислорода (АФК) [ 31 ].Однако, помимо приговоров к смерти апоптоза, клетки могут также использовать альтернативный путь удаления аберрантных митохондрий, который опосредуется селективной аутофагией, известной как «митофагия» [ 32 - 34 ]. Наиболее принципиальным митофагическим путем является PINK1-PRKN-зависимый путь. При потере митохондриального мембранного потенциала PINK1 (PTEN-индуцированная киназа 1) стабилизируется на OMM [ 35 - 37 ], фосфорилируя убиквитин и PRKN (убиквитин-протеин-лигаза паркин RBR E3), что способствует E3-лигазной активности PRKN, приводя к дальнейшему отложению убиквитина и накоплению PRKN в митохондриях [ 38 , 39 ].PRKN впоследствии опосредует убиквитинирование и деградацию митохондриальных резидентных белков, включая MFN1 (митофузин 1), MFN2 и VDAC1 (потенциал-зависимый анионный канал 1) через путь убиквитин-протеасома [ 40 - 43 ]. Этот механизм прямой связи по существу запускает поглощение митохондрий адаптерами убиквитина, что приводит к клиренсу митохондрий через лизосомную деградацию [ 44 - 46 ]. Физиологически, PINK1-PRKN-опосредованная митофагия сильно выражена в патогенности нейрональных заболеваний, особенно болезни Паркинсона [ 47 , 48 ].Мутации PINK1 и PRKN были обнаружены при болезни Паркинсона, что указывает на физиологическую важность PINK1-PRKN-зависимой митофагии. Интенсивно изучается, что в культивируемых клетках для индукции пути PINK1-PRKN необходимы острое повреждение митохондрий и токсикация. Митохондриальный разобщитель карбонилцианид 3-хлорфенилгидразон (CCCP) широко используется для деполяризации митохондрий, запуская транслокацию PRKN на поврежденные митохондрии. Однако очень мало известно о пороговом уровне «уязвимости» митохондрий к токсинам, которые могут стимулировать клетки к митофагии.

MIEF1 представляет собой белок внешней митохондриальной мембраны, содержащий однопроходный трансмембранный домен на N-конце, который прикрепляет белок к митохондриям, при этом основная часть белка обращена к цитозолю. MIEF1 был одновременно идентифицирован с MIEF2, который сходным образом обеспечивает механизм деления митохондрий посредством DNM1L [ 49 , 50 ]. Сверхэкспрессия MIEF1 или MIEF2 секвестрирует избыточную неактивную DNM1L на OMM, запрещая деление митохондрий. Напротив, истощение MIEF1 или MIEF2 отменяет олигомеризацию DNM1L на митохондриях, что приводит к удлинению или коллапсу митохондрий [ 49 - 52 ].Таким образом, уровни MIEF1 или MIEF2 имеют решающее значение для регуляции динамики митохондрий. Следует отметить, что баланс деления и слияния митохондрий служит множеству физиологических путей, включая гибель клеток и митофагию. В частности, сообщалось о различной роли MIEF1 в апоптозе. Было обнаружено, что дефицит MIEF1 сенсибилизирует клетки к апоптотическим стимулам [ 50 ], в то время как двойной нокаут (DKO) MIEF1 и MIEF2 , как сообщается, защищает клетки от внутреннего развития апоптоза посредством ремоделирования митохондрий

3 [5332 ].Т.о., неопределенность относительно точных ролей MIEF1 остается и

bona fide функция MIEF1 на митохондриях нуждается в дальнейшем рассмотрении.

Здесь мы наблюдаем, что канонический внутренний апоптотический стимул, STS, индуцировал специфическую деградацию MIEF1 через UPS, тесно связывая уровень экспрессии MIEF1 с апоптозом. Мы демонстрируем, что MIEF1 дефицит сенсибилизировал цитозольный BAX для перемещения в митохондрии, опосредованного повторной локализацией BCL2L1 (BCL2 как 1).Следовательно, сверхэкспрессия BAX собирается и олигомеризуется на OMM, чтобы индуцировать MOMP, высвобождая DIABLO и CYCS, чтобы облегчить гибель клеток в отсутствие эктопических апоптотических стимулов. Поразительно, что мы дополнительно раскрываем новую роль MIEF1, в которой истощение примированных клеток MIEF1 к быстрому всплеску рекрутирования PRKN при потере митохондриального мембранного потенциала и запускало начало PINK1-PRKN-зависимой митофагии через ускоренное разрушение MFN2 и FIS1. Наши результаты указывают на критическую роль MIEF1 в управлении контролем качества митохондрий, интеграции гибели клеток и митофагии.

Результаты

STS дестабилизировал MIEF1 через убиквитин-протеасомный путь

Митохондрии играют критическую роль в ответе как на внутренние, так и на внешние апоптотические стимулы, регулируя клеточный оборот [ 54 , 55 ]. Чтобы исследовать взаимосвязь между митохондриальной динамикой и апоптозом, мы сначала попытались изучить уровни экспрессии белков, участвующих в митохондриальной динамике в клетках HeLa, после обработки ряда различных апоптотических стимулов, включая STS, актиномицин D (ActD) и их комбинацию. TNF / TNF-α (фактор некроза опухоли) и циклогексимид (CHX).Учитывая наличие неспецифической полосы, близкой к размеру MIEF1 в цитозольной фракции, обнаруженной коммерческим антителом, мы извлекли митохондриальные фракции для анализа. Было обнаружено, что STS заметно снижает уровень белка MIEF1 в 0,69 ± 0,03 раза, в то время как уровни экспрессии других белков OMM, включая MIEF2, MFN1, MFN2, MFF и FIS1, остались неизменными ( Рисунок 1 (a, b) ). Снижение уровня белка MIEF1 после обработки STS не было специфичным для типа клеток, как и аналогичная потеря 0.81 ± 0,04 раза было подтверждено в клеточной линии U2OS ( Рисунок 1 (c, d) ). Чтобы проверить, способствует ли активность каспаз снижению уровня белка MIEF1, мы применили ингибитор панкаспаз, Q-VD-OPH, для подавления каталитической активности каспаз (рис. S1A). Q-VD-OPH не смог восстановить подавление уровня MIEF1 после обработки STS, что указывает на то, что STS регулирует уровень белка MIEF1, вероятно, выше MOMP. Чтобы определить, зависит ли влияние STS на стабильность MIEF1 от UPS, мы увеличили уровень MIEF1-Flag с помощью анти-Flag гранул после обработки STS.Существенное увеличение уровня полиубиквитинирования было обнаружено в иммунопреципитате MIEF1-Flag ( Рисунок 1 (e) ), что позволяет предположить, что STS подавляет MIEF1 через UPS. Этот вывод подтверждается данными, показывающими, что протеасомный ингибитор MG132 был способен стабилизировать и восстанавливать уровень MIEF1 после индукции STS ( Рисунок 1 (f, g) ).

Стауроспорин (STS) индуцирует селективную деградацию MIEF1 через убиквитин-протеасомный путь. ( a ) Клетки HeLa обрабатывали ДМСО, 100 нМ STS, 0.3 мкМ актиномицина D (ActD) или 20 нг / мл фактора некроза опухоли (TNF) плюс 3 мкг / мл циклогексимида (CHX) в течение 16 часов. Затем митохондриальные фракции клеток подвергали иммуноблоттингу. Звездочки указывают на неспецифические полосы. ( b ) Показана количественная оценка уровней MIEF2 и MIEF1 в ( a ). Показаны средние значения, определенные денситометрией из 3 независимых экспериментов. Уровни белков MIEF2 или MIEF1 были нормализованы до HSPD1. Планки погрешностей представляют собой стандартное отклонение (SD).*** P <0,001, NS, не значимо. ( c ) Митохондриальные фракции клеток U2OS, обработанные, как указано, анализировали с помощью иммуноблоттинга. ( d ) Уровни MIEF1 в клетках U2OS определяли количественно денситометрией в 3 независимых экспериментах. Полоски указывают среднее значение ± стандартное отклонение. *** P <0,001, NS, не значимо. ( e ) Клетки HeLa временно трансфицировали вектором с меткой Flag или MIEF1 и меченным MYC убиквитином в течение 24 часов.После обработки 100 нМ STS и 1 мкМ MG132 в течение 16 ч клетки лизировали и подвергали иммунопреципитации (IP) антителом против Flag. Продукты IP и клеточные лизаты выявляли с помощью анти-Flag и анти-Ub. Звездочки указывают на неспецифические полосы. ( f ) Митохондриальные фракции клеток HeLa, обработанные, как указано, подвергали SDS-PAGE. ( г ) Представлен уровень MIEF1, нормализованный к экспрессии HSPD1. Гистограмма представляет данные из 3 независимых экспериментов, как в ( f ).Планки погрешностей указывают на SD. *** P <0,001, NS, не значимо.

Потеря сенсибилизированных MIEF1 клеток на апоптотические стимулы

Учитывая корреляцию между обработкой STS и подавленным уровнем MIEF1, мы затем попытались охарактеризовать роль MIEF1 в апоптозе. Примечательно, что нокдаун MIEF1 способствовал апоптозу, как измерено по увеличению расщепленного PARP, в ответ как на внутренние, так и на внешние стимулы ( Рисунок 2 (a, b), ). Напротив, эктопическая экспрессия MIEF1, как было обнаружено, противодействует апоптозу после апоптотических стимулов (рис.S2A). Процент клеток, демонстрирующих высвобожденные DIABLO и CYCS, также увеличивался после инкубации с внутренним индуктором апоптоза, этопозидом или внешним токсином, комбинацией TNF и CHX, когда клетки были истощены на MIEF1 по сравнению с клетками, обработанными контролем или MIEF2 миРНК ( Рисунок 2 (c – e) ). Аналогичным образом, анализ клеток, обработанных миРНК MIEF1 с помощью проточной цитометрии, выявил повышенную популяцию суб-G 1 (, фиг.2 (f, g), ) и поглощение пропидия иодида (PI) (фиг.S2B и C), подтверждающие восприимчивость дефицита MIEF1 к гибели клеток. Кроме того, сенсибилизация к апоптозу была также обнаружена в клетках MCF7 с потерей MIEF1 после обработки актиномицином D или этопозидом (рис. S2D-F), что привело к такому же выводу, что MIEF1 важен для защиты клеток от апоптоза.

Дефицит MIEF1 повышает чувствительность клеток к апоптозу. ( a ) Клетки HeLa временно трансфицировали контролем или миРНК MIEF1 в течение 48 часов до указанной обработки в течение следующих 16 часов.Клетки лизировали и подвергали SDS-PAGE и иммуноблоттингу с использованием соответствующих антител. (b ) MIEF2 и MIEF1 молчание было обнаружено в клетках HeLa с помощью иммуноблоттинга. ( c ) Репрезентативные изображения, показывающие невыполнение или выпуск (обозначено белыми стрелками) CYCS (красный) и DIABLO (зеленый). Высвобождение CYCS и DIABLO индуцировали 20 нг / мл TNF плюс 3 мкг / мл CHX в течение 16 часов. Hoechst, синий. Шкала шкалы: 10 мкм. ( d и e ) Клетки HeLa, трансфицированные контролем, MIEF2 или MIEF1 siRNA обрабатывали 10 мкг / мл этопозида или 20 нг / мл TNF плюс 3 мкг / мл CHX в течение 16 часов.Показано количественное определение процента ячеек, отображающих выпуск DIABLO ( d ) или выпуск CYCS ( e ). Столбцы представляют собой среднее значение ± стандартное отклонение. n> 150 клеток из 3 независимых экспериментов. * P <0,05, ** P <0,01, *** P <0,001, NS, не значимо. ( f ) Клетки, трансфицированные указанной миРНК, обрабатывали 100 нМ STS в течение 16 часов и фиксировали. Фрагментацию ДНК выявляли окрашиванием PI. Процент популяции суб-G 1 (в которой клеточная ДНК расщепляется как фракционное на поздней стадии апоптоза) показан как среднее значение ± стандартное отклонение.( G ) Количественная оценка популяции суб-G 1 показана на основе 3 независимых экспериментов, как в ( f ). Bas указывают среднее ± стандартное отклонение. ** P <0,01, NS, не значимо.

Дефицит MIEF1 запускает транслокацию и олигомеризацию BAX на митохондриях

BAX рассматривается как проапоптотический эффектор, необходимый для митохондриально-опосредованного апоптоза [ 13 , 56 ]. Неактивный BAX находится преимущественно в цитозоле, тогда как активированный BAX рекрутируется и собирается в виде фокусов на OMM, где он опосредует MOMP.В попытке исследовать функцию MIEF1 на транслокацию BAX, мы подавили различные белки OMM и визуализировали субклеточную локализацию GFP-tagged BAX. Интересно, что нокдаун MIEF1 специфически приводит к транслокации GFP-BAX в митохондрии, снижению потенциала митохондриальной мембраны (на что указывает MitoTracker Red) и высвобождению DIABLO ( Рисунок 3 (a – d), и Фиг. S3A). Увеличение транслокации BAX было получено с использованием двух независимых миРНК, нацеленных на MIEF1 (рис.S3B-D). Доля клеток с кластеризованными BAX на митохондриях была значительно увеличена с 1,8 ± 0,3% в контрольных клетках, трансфицированных миРНК, до 35,1 ± 2,1% в клетках, трансфицированных миРНК № 1 MIEF1 , и 31,7 ± 1,9% в клетках, трансфицированных MIEF1 миРНК №2 соответственно. Однако нокдаун других генов, участвующих в митохондриальной динамике, включая FIS1, MFF, DNM1L, MIEF2, MFN1 и MFN2 , не смог вызвать рекрутирование BAX, что свидетельствует об исключительной регуляции MIEF1 на BAX ( Рисунок 3 (a, б) и рис.S3A). В MIEF1 -беззвучных клетках HeLa обильная транслокация GFP-BAX была связана с более эффективным высвобождением DIABLO и CYCS ( Рисунок 3 (c, d) ). Кроме того, повышенная олигомеризация BAX на митохондриях в истощенных MIEF1 клетках была подтверждена сшивкой 1,6-бисмалеимидогексаном (BMH) ( Рисунок 3 (e – g) ). Следует отметить, что помимо BAX потеря MIEF1 также индуцировала BAK1-опосредованную деполяризацию митохондрий (Fig. S3E-G), подчеркивая критическую роль MIEF1 в митохондриально-зависимом апоптозе в ответ на проапоптотические эффекторы BAX и BAK1.Как и ожидалось, повторная экспрессия MIEF1-MYC (Mus musculus) обращала накопление BAX в истощенных MIEF1 клетках HeLa ( фиг. 3 (h, i) ). Наряду с этой линией мы стремились определить транслокацию эндогенного BAX с помощью апоптотических стимулов TNF плюс CHX ( Рисунок 4 (a, b) ). Следует отметить, что транслокация эндогенного BAX увеличилась с 15,1 ± 1,0% в клетках, трансфицированных контрольной siRNA, до 56,8 ± 2,26% в клетках, подавленных siRNA MIEF1 , что подтверждает роль MIEF1 в управлении перемещением BAX между цитозолем и митохондриями. .Вместе мы демонстрируем, что потеря MIEF1 приводила к транслокации и олигомеризации BAX на митохондриях. Впоследствии MOMP привел к высвобождению DIABLO и CYCS, чтобы инициировать апоптоз.

MIEF1 регулирует BAX. ( a ) Клетки HeLa трансфицировали указанной миРНК в течение 24 часов. Затем клетки трансфицировали GFP-tag BAX (зеленый) в течение следующих 24 часов. Клетки инкубировали с MitoTracker Red (MTR, красный) в течение 15 мин, а затем фиксировали и иммуноокрашивали на DIABLO (голубой).Hoechst, синий. Шкала шкалы: 10 мкм. Стрелки указывают клетки с транслокацией BAX. (b ) Количественная оценка транслокации GFP-BAX в митохондрии, как показано в ( a ). Столбцы представляют собой среднее значение ± стандартное отклонение. *** P <0,001. n> 150 клеток для каждой группы из 3 независимых экспериментов. ( c ) Клетки HeLa трансфицировали указанной siRNA в течение 24 часов и GFP-tag BAX (зеленый) в течение следующих 24 часов, затем фиксировали и иммуноокрашивали на DIABLO (красный) и CYCS (голубой).Hoechst, синий. Шкала шкалы: 10 мкм. Стрелки указывают клетки с транслокацией BAX. ( d ) Количественная оценка транслокации GFP-BAX в митохондрии, как в ( c ). Столбцы представляют собой среднее значение ± стандартное отклонение. *** P <0,001, NS, не значимо. n> 150 клеток для каждой группы из 3 независимых экспериментов. ( e ) Клетки обрабатывали контролем или миРНК MIEF1 в течение 48 часов перед трансфекцией BAX с меткой Flag в течение следующих 24 часов. Олигомеризацию Flag-BAX в митохондриальной фракции определяли путем сшивания с использованием 2 мМ BMH.( f ) Количественное определение мономера Flag-BAX, как показано в ( e ). Мономер Flag-BAX был нормализован до TUBB (цитозоль) или TIMM23 (митохондрии). Цитозольный или митохондриальный мономер Flag-BAX выражали как процент от общего мономера Flag-BAX. Данные представляют собой средние значения ± стандартное отклонение (n = 3). * P <0,05. ( г ) Отношение димера или тримера ВАХ к мономеру в митохондриальной фракции количественно определяли в 3 независимых экспериментах, как в ( e ). Полоски указывают средние значения ± стандартное отклонение.* P <0,05. ( ч ) Клетки HeLa трансфицировали контролем или миРНК MIEF1 в течение 24 часов перед трансфекцией вектором с меткой MYC или Mief1 (Mus musculus) плюс BAX (зеленый) с GFP в течение следующих 24 часов, затем фиксированный и иммуноокрашенный на DIABLO (красный) и MYC (голубой). Hoechst, синий. Шкала шкалы: 10 мкм. Стрелки указывают клетки с транслокацией BAX. ( i ) Оценка транслокации GFP-BAX в митохондрии, как в ( ч ).Планки погрешностей представляют стандартное отклонение. *** P <0,001. n> 150 клеток для каждой группы из 3 независимых экспериментов.

Транслокация BAX, индуцированная потерей MIEF1, опосредуется ретранслокацией BCL2L1. ( a ) Клетки HeLa трансфицировали миРНК, как указано, в течение 48 часов. Затем клетки обрабатывали 20 нг / мл TNF плюс 3 мкг / мл CHX в течение следующих 16 часов. После этого клетки фиксировали и иммуноокрашивали на CYCS (красный) и эндогенный BAX (зеленый). Hoechst, синий. Шкала шкалы: 10 мкм. Стрелки указывают клетки с транслокацией BAX на митохондриях.( b ) Транслокацию эндогенного BAX количественно оценивали в 3 независимых экспериментах, как в ( a ). Планки погрешностей представляют стандартное отклонение. *** P <0,001. n> 150 клеток для каждой группы из 3 независимых экспериментов. ( c ) Клетки трансфицировали контрольной или миРНК MIEF1 в течение 72 часов. Цитозольные и митохондриальные фракции были извлечены, и члены семейства BCL2 были обнаружены с помощью иммуноблоттинга. Звездочка указывает на неспецифическую полосу. ( d ) Показано количественное определение BCL2L1 в ( c ).BCL2L1 был нормализован до TUBB (цитозоль) или TIMM23 (митохондрии). Цитозольный или митохондриальный BCL2L1 выражали как процент от общего BCL2L1. Данные представляют собой средние значения ± стандартное отклонение (n = 3). *** P <0,001. ( e ) Клетки HeLa котрансфицировали указанными плазмидами. Через 24 ч клетки экстрагировали и коиммунопреципитировали с помощью гранул против Flag с последующим иммуноблоттингом с антителами против MYC и против Flag соответственно. ( f ) Клетки HeLa трансфицировали контролем или миРНК MIEF1 в течение 24 часов.Затем клетки трансфицировали вектором, меченным mCherry, или BCL2L1 (красный) плюс GFP- BAX (зеленый) в течение следующих 24 часов. Клетки фиксировали и иммуноокрашивали антителом против CYCS (голубой). Hoechst, синий. Шкала шкалы: 10 мкм. ( г ) Оценка транслокации GFP-BAX в митохондрии, как в ( f ). Столбик представляет собой среднее значение ± стандартное отклонение. *** P <0,001. n> 100 клеток для каждой группы из 3 независимых экспериментов. ( ч ) Клетки HeLa трансфицировали контролем или миРНК MIEF1 в течение 24 часов перед трансфекцией вектором, меченным MYC, или BCL2L1 в течение следующих 24 часов.Далее клетки обрабатывали ДМСО или 0,3 мкМ актиномицина D в течение 16 часов. Лизаты анализировали с помощью SDS-PAGE и иммуноблоттинга.

MIEF1 регулирует BAX через BCL2L1, но независимо от DNM1L

Учитывая тесную взаимосвязь между апоптозом и митохондриальной динамикой, мы рассмотрели роль DNM1L в транслокации BAX при истощении MIEF1 . Когда мы заглушили MIEF1 в клетках с нокдауном DNM1L , мы обнаружили, что дефицит DNM1L не мешал транслокации BAX в MIEF1 -истощенных клетках, хотя свидетельства удлинения митохондрий были очевидны (рис.S4A-C). В соответствии с этим открытием, мы не наблюдали заметного снижения рекрутирования BAX после нокдауна MIEF1 в клетках, экспрессирующих доминантно-отрицательный мутант DNM1L (DNM1L K38A ) (рис. S4D и E), что свидетельствует о модуляции рекрутирования BAX. потеря MIEF1 не зависит от митохондриальной динамики.

Затем мы предположили, что дефицит MIEF1 может придавать чувствительность к апоптозу через запуск дисбаланса членов семейства BCL2.Чтобы проверить это, мы проанализировали уровни антиапоптотических модуляторов, включая BCL2L1 и BCL2, в митохондриальной фракции MIEF1 -истощенных клеток. Мы обнаружили, что повышенный уровень митохондриального BCL2L1 перемещается в цитозоль в MIEF1 -молчащих клетках ( Рисунок 4 (c, d) ). Кроме того, митохондриальный BCL2 фосфорилировался по остатку Ser87, что указывает на подавленный антиапоптотический потенциал [ 57 ]. Однако, что несколько удивительно, мы не смогли обнаружить транслокацию эндогенного BAX в митохондрии при истощении MIEF1 в базальных условиях без эктопического апоптотического стимула, хотя это согласуется с предыдущим сообщением [ 53 ].Мы пришли к выводу, что уменьшение митохондриального BCL2L1 мало влияет на изменение локализации эндогенного BAX, который находится на низком уровне в митохондриях. Однако, когда присутствует избыточный уровень BAX, например, в случае сверхэкспрессии BAX, снижения митохондриального BCL2L1, опосредованного дефицитом MIEF1 , будет достаточно для рекрутирования цитозольного BAX в митохондрии. Это может объяснить наше более раннее наблюдение, согласно которому истощение MIEF1 было способно вызвать апоптоз, когда мы одновременно сверхэкспрессировали BAX, но в отсутствие эктопических стимулов ( Рисунок 3 ).Чтобы дополнительно прояснить взаимосвязь между BCL2L1 и MIEF1 в регуляции BAX, мы подтвердили взаимодействие BCL2L1 с MIEF1, но не с MIEF2, путем коиммунопреципитации ( Рисунок 4 (e) ), предполагая селективную регуляцию между MIEF1 и BCL2L1. , что может объяснять транслокацию BAX в MIEF1 -истощенных клетках. В соответствии с этим предположением, сверхэкспрессия mCherry-BCL2L1, которая локализуется исключительно в митохондриях, существенно ингибирует олигомеризацию митохондриального BAX и активацию каспазы ( Рисунок 4 (f-h) ).Взятые вместе, наши данные показывают, что MIEF1 может управлять уровнем митохондриального BCL2L1, который впоследствии регулирует транслокацию избыточного BAX в митохондрии для приверженности апоптозу, в то время как эта специфическая функция MIEF1 на BAX не зависит от DNM1L-опосредованного деления митохондрий.

Истощение MIEF1 способствует митофагии, опосредованной PINK1-PRKN

Основываясь на сопутствующей регуляции между путями, способствующими смерти и способствующими выживанию, среди которых митохондрии играют решающую роль, мы стремились определить важность MIEF1 для самозащиты митохондрий, в частности «митофагия».Известно, что индукция опосредованной PINK1-PRKN митофагии происходит в клетках млекопитающих при воздействии митохондриального токсина. С этой целью мы трансфицировали клетки HeLa, стабильно экспрессирующие GFP-PRKN (называемые HeLa: GFP-PRKN), с siRNA, нацеленными на MIEF2, MIEF1 или DNM1L , и отслеживали митофагию после деполяризации митохондрий, индуцированной CCCP ( Рисунок 5 ( a – c) , Рис. S5A и B). Поразительно, что митофагия была резко усилена заглушением MIEF1 , о чем свидетельствует потеря митохондриальных белков, анализируемая с помощью иммунофлуоресценции и иммуноблоттинга.Чтобы еще раз подтвердить это, мы использовали клетки HeLa, стабильно экспрессирующие YFP-PRKN и mt-mKeima, и исследовали соотношение подкисленных митофагосом как количественный индикатор митофагии с помощью проточной цитометрии [ 46 ]. При заглушении MIEF1 мы наблюдали увеличение доли CCCP-индуцированной митофагии с 50,3 ± 2,2% контрольных клеток, трансфицированных siRNA, до 92,3 ± 3,6% ( Рисунок 5 (d) и Фиг. S5C). Более высокая чувствительность к PINK1-PRKN-зависимой митофагии была также обнаружена в истощенных по MIEF1 клетках в ответ на другие индукторы митофагии, включая олигомицин плюс антимицин A (OA) и валиномицин (рис.S5D), несмотря на наши более ранние наблюдения, что эти токсины, в отличие от STS, были неспособны вызвать заметную деградацию MIEF1 в клетках HeLa, не экспрессирующих PRKN (рис. S1B). Чтобы убедиться, что мы наблюдаем целевые эффекты миРНК MIEF1 , мы снова применили дополнительную миРНК MIEF1 ( MIEF1 миРНК # 2) к клеткам HeLa: GFP-PRKN и получили согласованные результаты, подтверждающие, что сенсибилизация митофагии была из-за специфического истощения MIEF1 (рис.S5E-G). Подтверждая наши данные о митофагии, клетки HeLa: GFP-PRKN, истощенные по MIEF1 , также обнаруживают повышенную кинетику рекрутирования PRKN на ранних стадиях лечения CCCP ( Рисунок 5 (e-h) ). В соответствии с этим результатом мы наблюдали повышенное рекрутирование GFP-PRKN в митохондрии в ответ на лечение OA и валиномицином (рис. S5H-J), хотя нам не удалось обнаружить повышение стабильности PINK1 за счет потери MIEF1 (рис. S5K). Взятые вместе, наши результаты демонстрируют, что дефицит MIEF1 придает чувствительность к транслокации PRKN и митофагии, индуцированной потерей потенциала митохондриальной мембраны.

Утрата MIEF1 приводит клетки к PINK1-PRKN-зависимой митофагии. ( a ) Клетки HeLa, стабильно экспрессирующие GFP-PRKN (зеленый), трансфицировали указанной миРНК в течение 48 часов. Затем клетки обрабатывали ДМСО или 10 мкМ CCCP в течение 16 часов с последующим иммуноокрашиванием антителом против TOMM20 (красный). Hoechst, синий. Шкала шкалы: 10 мкм. Звездочки указывают на митофагические клетки. ( b ) Опосредованная PRKN митофагия, показанная как ( a ), была определена количественно. Данные представляют собой среднее значение ± стандартное отклонение. ** P <0.01. n> 150 клеток для каждой группы из 3 независимых экспериментов. ( c ) Общие клеточные лизаты, обработанные как в ( a ), подвергали SDS-PAGE и иммуноблоттингу. ( d ) Клетки HeLa, стабильно экспрессирующие YFP-PRKN и mt-mKeima, трансфицировали контролем или миРНК MIEF1 в течение 48 часов. Затем клетки обрабатывали ДМСО или 10 мкМ CCCP в течение следующих 16 часов с последующим анализом проточной цитометрии. ( e ) Клетки HeLa, стабильно экспрессирующие GFP-PRKN (зеленый), трансфицированные указанной миРНК в течение 48 ч, обрабатывали ДМСО или 5 мкМ CCCP в течение указанного времени.Затем клетки фиксировали и иммуноокрашивали на TOMM20 (красный) и убиквитин (голубой). Hoechst, синий. Масштабная линейка 10 мкм. Стрелки указывают на транслокацию PRKN. ( f ) Количественная оценка рекрутирования PRKN на митохондрии, как в ( e ). Точки данных представляют собой среднее значение ± стандартное отклонение. n> 150 клеток для каждой группы из 3 независимых экспериментов. ( г ) Иммуноблоттинг-анализ цитозольных или митохондриальных фракций, как в ( e ), обработанных 5 мкМ CCCP в течение 0 часов или 1,5 часов соответственно.( ч ) Количественный анализ ( г ). GFP-PRKN нормализовали до TUBB (цитозоль) или TIMM23 (митохондрии). Данные представлены в виде процента от общего GFP-PRKN, нормализованного к митохондриальной фракции контрольной группы siRNA после обработки CCCP. Полоса ошибок указывает SD из 3 независимых повторов. * P <0,05.

Избыточная экспрессия MIEF1 придает устойчивость к PINK1-PRKN-зависимой митофагии

Учитывая влияние MIEF1 на PINK1-PRKN-опосредованную митофагию, мы предположили, что уровень MIEF1 имеет отношение к митохондриальному гомеостазу, при котором избыточная экспрессия MIEF1 может подавлять .Чтобы исследовать это, мы изучили транслокацию PRKN на ранних этапах лечения CCCP в течение 1,5 часов. Эктопическая экспрессия Mief1 действительно была способна блокировать рекрутирование PRKN на деполяризованные митохондрии ( Рисунок 6 (a, b) ) и замедлять деградацию митохондриальных белков, включая кодируемый митохондриальной ДНК MT-CO2, белок внутренней мембраны митохондрий. TIMM23 и белок внешней митохондриальной мембраны TOMM20, по сравнению с экспрессирующими вектор клетками ( фиг. 6 (c – f) ), предполагая антагонистический эффект MIEF1 на митофагию.Однако потеря PINK1 значительно устраняет рекрутирование PRKN и митофагию, даже в MIEF1 -дефицитных клетках ( Figure 6 (g – k) ), подразумевая существенную потребность в PINK1 для регулируемой митофагии MIEF1. Таким образом, мы пришли к выводу, что уровень MIEF1 является критическим для кинетики пути митофагии, опосредованной PINK1-PRKN.

Сверхэкспрессия MIEF1 препятствует митофагии, опосредованной PINK1-PRKN. ( a ) Клетки HeLa трансфицировали вектором, меченным MYC, или вектором Mief1 (голубой) плюс PRKN , меченным GFP, в течение 24 часов.Затем клетки обрабатывали ДМСО или 5 мкМ CCCP в течение 1,5 ч с последующим иммуноокрашиванием антителами против TOMM20 (красный) и против MYC (голубой). Hoechst, синий. Шкала шкалы: 10 мкм. Клетки с транслокацией PRKN, индуцированной 1,5-часовой обработкой CCCP, показаны белыми стрелками, тогда как клетки без транслокации PRKN при обработке CCCP показаны желтыми стрелками. ( b ) Была проведена количественная оценка транслокации PRKN в митохондрии, показанной как ( a ). Данные представляют собой среднее значение ± стандартное отклонение. *** P <0.001. n> 100 клеток для каждой группы из 3 независимых экспериментов. ( c ) Клетки HeLa, стабильно экспрессирующие GFP-PRKN, трансфицировали вектором, меченным MYC, или Mief1 в течение 24 часов. Затем клетки обрабатывали 10 мкМ CCCP в течение указанного времени. Общие клеточные лизаты подвергали SDS-PAGE и иммуноблоттингу. ( d - f ) Соответствующие количества указанных митохондриальных белков, как в ( c ), были количественно определены в 3 независимых экспериментах. Уровни белка были нормализованы до TUBB без лечения CCCP.Планки погрешностей указывают на SD. ( г, и ч, ) Клетки HeLa, стабильно экспрессирующие GFP-PRKN, трансфицировали контролем или миРНК PINK1 в течение 24 часов. Клетки трансфицировали контрольной или миРНК MIEF1 в течение следующих 48 часов. Митохондрии визуализировали путем иммуноокрашивания на TOMM20 (красный) после обработки 5 мкМ CCCP в течение 1,5 ч ( г ) или 10 мкМ CCCP в течение 16 ч ( ч ). Звездочки указывают на митофагические клетки. ( i и j ) Рекрутирование GFP-PRKN на митохондрии в ( g ) или процент митофагии в ( h ) оценивали в 3 независимых экспериментах.Данные представляют собой среднее значение ± стандартное отклонение. ** P <0,01, *** P <0,001. n> 150 клеток для каждой группы. ( k ) PINK1 сайленсинг был обнаружен в клетках HeLa: GFP-PRKN с помощью иммуноблоттинга. Звездочка указывает на неспецифическую полосу.

Потеря MIEF1 вызывает митофагию через деградацию MFN2 и FIS1

Механически накопление PRKN и убиквитина во время митофагии служит для деградации белков OMM, включая MFN1, MFN2 и VDAC1 [ 40 58 9032].Учитывая модуляцию MIEF1 на рекрутирование PRKN и митофагию, мы стремились исследовать уровни белков OMM в MIEF1 -истощенных клетках. Примечательно, что селективному снижению MFN2 и FIS1 способствовала потеря MIEF1 после короткого воздействия лечения CCCP, но не в контроле или MIEF2 нокдаун клетках ( Рисунок 7 (a – c) ). Однако добавление ингибитора протеасом MG132 предотвращает деградацию MFN2 и FIS1, сенсибилизированных дефицитом MIEF1 .Напротив, никакого эффекта ингибитора аутофагии хлорохина (CQ) не наблюдалось ( Рисунок 7 (d – f) ), что указывает на то, что на ранней стадии (обработка CCCP в течение 1,5 ч) истощение MIEF1 привело к быстрой деградации MFN2. и FIS1 через ИБП. Для дальнейшего решения этой проблемы мы увеличили уровень Flag-tagged MFN2 или FIS1 в MIEF1 -дефицитных клетках и обнаружили значительный всплеск убиквитинирования на ранней фазе CCCP-индуцированной транслокации PRKN ( Рисунок 7 (g, h) и рис.S6A). Более того, MG132 был способен отменить рекрутирование PRKN на ранней стадии (обработка CCCP в течение 1,5 часов) и митофагию на поздней стадии (обработка CCCP в течение 16 часов) в клетках, обработанных миРНК MIEF1 (рис. S6B-D), выявление тесной взаимосвязи между UPS и митофагией, которая, вероятно, зависит от деградации MFN2 и FIS1.

MIEF1 регулирует митофагию, опосредованную PINK1-PRKN, через MFN2 и FIS1. ( a ) Клетки HeLa, стабильно экспрессирующие GFP-PRKN, трансфицировали указанной миРНК в течение 70 часов.Затем клетки обрабатывали ДМСО или 5 мкМ CCCP в течение 1,5 ч с последующим иммуноблоттингом митохондриальных белков. Звездочки указывают на неспецифические полосы. ( b и c ) Средние уровни MFN2 ( b ) или FIS1 ( c ) были нормализованы до уровня TOMM20, представленного с SD, обозначенным планками ошибок из 3 независимых экспериментов, как в ( а ). * P <0,05, ** P <0,01, NS, недостоверно. ( d ) Клетки HeLa, стабильно экспрессирующие GFP-PRKN, трансфицировали указанной миРНК в течение 70 часов.Клетки обрабатывали 5 мкМ CCCP на 1,5 часа. MG132 или CQ был добавлен за 4 часа до этого с CCCP. Иммуноблоттинг лизатов цельных клеток. ( e и f ) Средние уровни MFN2 ( e ) или FIS1 ( f ) были нормализованы до уровня TOMM20. Планки погрешностей указывают стандартное отклонение от 3 независимых экспериментов, как в ( d ). ** P <0,01, NS, не значимо. ( г и ч ) Клетки HeLa, стабильно экспрессирующие GFP-PRKN, трансфицировали контролем или миРНК MIEF1 в течение 24 часов.Помеченный флагом вектор или Mfn2 ( г ), вектор с флагом FIS1 ( ч ) временно трансфицировали в клетки в течение следующих 24 часов. Ко-IP с использованием гранул anti-Flag выполняли после обработки CCCP в присутствии MG132 в течение 1,5 часов. Лизаты клеток и продукты co-IP подвергали SDS-PAGE и детектировали иммуноблоттингом. ( i и j ) Клетки HeLa трансфицировали указанными плазмидами. Через 24 ч клетки обрабатывали 5 мкМ CCCP еще 1 раз.5 ч, экстрагировали и подвергали со-IP с использованием анти-Flag гранул с последующим иммуноблоттингом. ( k ) Клетки HeLa, стабильно экспрессирующие GFP-PRKN (зеленый), трансфицировали контролем, миРНК FIS1, или MFN2, в течение 24 часов, а затем трансфицировали контрольными миРНК или миРНК MIEF1 в течение следующих 24 часов. Клетки обрабатывали ДМСО или 10 мкМ CCCP в течение 16 часов, далее фиксировали и иммуноокрашивали на TOMM20 (красный) и TIMM23 (голубой). Hoechst, синий. Шкала шкалы: 10 мкм. Клетки, отмеченные звездочками, обозначают митофагические клетки.(-1 ) FIS1 и MFN2 подавление ( k ) было обнаружено в клетках HeLa, стабильно экспрессирующих GFP-PRKN, с помощью иммуноблоттинга. ( m ) Опосредованная PRKN митофагия, показанная как ( k ), была определена количественно. Данные представляют собой среднее значение ± стандартное отклонение. *** P <0,001, NS, не значимо. n> 150 клеток для каждой группы из 3 независимых экспериментов.

Затем мы рассмотрели конкретное регулирование MIEF1 по MFN2 и FIS1. Было обнаружено, что MIEF1, но не MIEF2, специфически взаимодействует с эндогенным FIS1 посредством иммунопреципитации (рис.S6E). Более того, короткое воздействие CCCP (1,5 часа) привело к заметному увеличению связывания между MIEF1 и FIS1 ( Рисунок 7 (i), и Рисунок S6F), а также между MIEF1 и MFN2 ( Рисунок 7 (j). и рис. S6G). Однако не наблюдалось видимых изменений в ассоциации MIEF1 и MFN1 в присутствии CCCP (рис. S6H и I). Когда мы обратились к молчанию FIS1 и MFN2 , чувствительность к митофагии, индуцированная дефицитом MIEF1 , была серьезно отменена с 83.От 9 ± 2,5% до 34,4 ± 4,0% или 15,5 ± 1,5% соответственно ( Рисунок 7 (k – m) ). Вероятно, количественное ратиометрическое измерение анализа mt-mKeima дополнительно показало, что дефицит MFN2 приводит к значительному снижению митофагических клеток с долей с 91,15 ± 1,76%, в сочетании с потерей MIEF1, до 49,73 ± 9,0% после 16-часовой обработки CCCP на 10 мкМ (рис. S7), дополнительно демонстрируя, что регуляция FIS1 и MFN2, опосредованная путем UPS, является предварительной для митофагии.

Интересно, что MFN2 был описан как связка митохондрий-ER [ 59 ].Механически уменьшение контактов митохондрий с ER за счет потери MFN2 способствует митофагии, что подтверждается анализом mt-mKeima клеток U2OS при 20 мкМ CCCP в течение 4 часов. Тем не менее, наши результаты показывают, что MFN2 является критическим для митофагии, при которой истощение MFN2 отменяет митофагию при 10 мкМ CCCP в течение 16 часов ( Рисунок 7 (k – m) ). Чтобы устранить это несоответствие, мы предположили, что будет существовать специфический ответ, связанный с MFN2, адаптирующийся к разным стадиям митофагии. Как и ожидалось, мы действительно наблюдали отличительную регуляцию MFN2 при прогрессировании PINK1-PRKN-зависимой митофагии (рис.S7). При раннем начале митофагии (10 мкМ CCCP в течение 2 ч) соотношение митофагии увеличивалось с 6,59 ± 0,7% в клетках, трансфицированных контрольной миРНК, до 22,0 ± 3,5% в клетках, обработанных миРНК MFN2, , подтверждая функцию MFN2 как mitochondria-ER связка в ранней фазе PINK1-PRKN-опосредованной митофагии [ 59 ]. Напротив, на поздней стадии PINK1-PRKN-зависимой митофагии (10 мкМ CCCP в течение 16 часов) дефицит MFN2 надежно уничтожил популяцию клеток с подкисленным mt-mKeima, по сравнению с клетками, трансфицированными контрольной siRNA (уменьшено с 65 .18 ± 3,72% до 44,74 ± 5,08%) или клетки, заглушенные MIEF1 (уменьшились с 91,15 ± 1,76% до 49,73 ± 9,0%), что согласуется с нашими наблюдениями с использованием иммунофлуоресценции ( Рисунок 7 (k – m) ). Эти данные демонстрируют, что MFN2 может играть важную роль в альтернативных путях развития митофагии. Взятые вместе, наши результаты убедительно подтверждают, что убиквитинирование и деградация MFN2 и FIS1 через UPS, который сенсибилизируется потерей MIEF1, делает возможным удаление митохондрий.

Дефицит MIEF1 нарушает митохондриальное дыхание в сочетании с накоплением митохондриальных ROS

Учитывая влияние потери MIEF1 на митофагию, опосредованную PINK1-PRKN, мы затем определили влияние истощения MIEF1 на митохондриальную дисфункцию. Трансфекция миРНК MIEF1 в клетки HeLa приводила к аберрантному метаболизму митохондрий, о чем свидетельствует резкое снижение базовой и максимальной скорости потребления кислорода (OCR) ( Рисунок 8 (a, b) ).Окислительный стресс считается ключевым интегрирующим фактором митохондриальных дефектов и митофагии [ 60 , 61 ]. Таким образом, мы предположили возможность того, что потеря MIEF1 может запускать сверхпродукцию митохондриальных ROS, которые впоследствии приводят клетки к PINK1-PRKN-опосредованной митофагии. Используя MitoSOX для измерения митохондриальных АФК, мы наблюдали увеличение продукции АФК в 0,44 ± 0,11 раза при подавлении MIEF1 в клетках HeLa, стабильно экспрессирующих HA-PRKN ( Рисунок 8 (c, d) ).Чтобы проверить влияние митохондриальных АФК из-за потери MIEF1 на митофагию, опосредованную PINK1-PRKN, мы применили нейтрализатор АФК N-ацетил-L-цистеин (NAC), известный антиоксидант, для оценки прогрессирования митофагии [ 62 , 63 ]. В присутствии NAC в клетках HeLa: GFP-PRKN как транслокация PRKN (обработка CCCP в течение 1,5 часов), так и митофагия (обработка CCCP в течение 16 часов) при подавлении молчания MIEF1 были значительно уменьшены ( Рисунок 8 (e, f) ), показывая, что митохондриальный окислительный стресс, возникающий из-за потери MIEF1, способствует PINK1-PRKN-зависимому клиренсу деполяризованных митохондрий.

Недостаток MIEF1 приводит к дисфункции митохондриального дыхания и накоплению митохондриальных АФК. ( a ) Типичная скорость потребления кислорода (OCR) с течением времени показана для клеток HeLa, трансфицированных контролем или миРНК MIEF1 в течение 72 часов. Олигомицин 1 мкМ, CCCP 0,5 мкМ, ротенон 1 мкМ плюс 1 мкМ антимицина А, соответственно, вводили в указанное время. ( b ) Показаны скомпилированные анализы базального и максимального OCR. Планки погрешностей указывают на SD. *** P <0.001. n = 8 для каждой группы из 3 независимых экспериментов. ( c ) Клетки HeLa, стабильно экспрессирующие HA-PRKN, трансфицировали контролем или миРНК MIEF1 в течение 72 часов. Клетки окрашивали красителем MitoSOX Red и подвергали анализу FACS. Показаны гистограммы количества клеток в сравнении с флуоресценцией MitoSOX Red. ( d ) Количественная оценка средней интенсивности флуоресценции (MFI) MitoSOX из 3 экспериментов, как в ( c ). Планки погрешностей указывают на SD. * P <0,05. ( e ) Клетки HeLa, стабильно экспрессирующие GFP-PRKN, трансфицировали контролем или миРНК MIEF1 в течение 48 часов.Клетки предварительно обрабатывали ДМСО или 2 мМ NAC в течение 4 часов с последующей обработкой CCCP с NAC или без него в течение еще 1,5 или 16 часов. Клетки фиксировали и окрашивали против TOMM20 (красный) и убиквитин (голубой). Hoechst, синий. Шкала шкалы: 10 мкм. Стрелки указывают на транслокацию PRKN. Клетки, отмеченные звездочками, обозначают митофагические клетки. ( f ) Количественная оценка транслокации PRKN через 1,5 часа или митофагии через 16 часов после лечения CCCP. Данные взяты из 3 независимых экспериментов ( e ).Планки погрешностей указывают на SD. ** P <0,01, *** P <0,001.

Учитывая активацию расщепления PARP, которую мы наблюдали в клетках HeLa, стабильно экспрессирующих GFP-PRKN, связанный с подавлением MIEF1 ( Рисунок 7 (a) ), у нас возникает соблазн изучить роль NAC в PINK1- PRKN-зависимая гибель клеток в начале митофагии (рис. S8A и B). Следует отметить, что NAC значительно ингибирует гибель клеток, хотя она может быть сенсибилизирована дефицитом MIEF1 , полагаясь на PRKN.Затем мы попытались выяснить, является ли накопление митохондриальных АФК причиной BAX-опосредованного апоптоза. Удивительно, но в отличие от клеток HeLa, стабильно экспрессирующих HA-PRKN ( фиг. 8 (c, d) ), митохондриальные ROS клеток HeLa, лишенных PRKN, не наблюдали увеличения за счет потери MIEF1 (фиг. S8C). Соответственно, ни транслокация BAX, ни расщепление PARP, сенсибилизируемое дефицитом MIEF1 , не устранялось NAC (рис. S8D-G), что подтверждает мнение о том, что митохондриальный окислительный стресс из-за потери MIEF1 является пермиссивным PRKN-специфическим образом и избирательно способствует к PINK1-PRKN-зависимой митофагии.

Обсуждение

Наше текущее исследование проясняет точные и специфические роли MIEF1 в отношении митохондриально-ассоциированных процессов, включая митохондриально-зависимый апоптоз и опосредованную PINK1-PRKN митофагию ( Рисунок 9 ). Наше наблюдение, что внутренний апоптотический стимул STS индуцирует UPS-зависимую деградацию MIEF1, побуждает нас исследовать функцию MIEF1 в апоптозе. Следует отметить, что в предыдущих исследованиях сообщалось о вызывающих недоумение результатах для MIEF1 в отношении гибели клеток.Сверхэкспрессия MIEF1, как сообщается, ведет к снижению расщепления PARP в ответ на лечение STS, тогда как, наоборот, RNAi-обусловленное молчание MIEF1 увеличивает апоптоз [ 50 ]. Однако независимое исследование заявило, что mief1 и mief2 DKO клетки устойчивы к внутреннему апоптозу посредством ремоделирования митохондриальных крист в зависимости от DNM1L [ 53 ]. Здесь мы охарактеризуем специфическую автономную регуляцию с помощью MIEF1 BAX-опосредованной гибели клеток, которая, как мы находим, не зависит от DNM1L-опосредованного деления митохондрий и не наблюдается для MIEF2.Интересно, что истощение MIEF1 способствует диссоциации BCL2L1 из митохондрий, что, в свою очередь, способствует рекрутированию цитозольного BAX в митохондрии, посредством чего становится доступным избыточное количество BAX. Следовательно, накопленный BAX в отсутствие MIEF1 инициирует MOMP, высвобождая CYCS и DIABLO для активации каспаз для прогрессирования апоптоза. Разумные интерпретации противоречивых результатов между нашими находками здесь с использованием siRNA по сравнению с клетками mief1 и mief2 DKO могут быть результатом различных методов, используемых для индукции апоптоза.Мы исследовали локализацию сверхэкспрессируемого GFP-BAX без эктопического стимула, тогда как влияние mief1 и mief2 DKO на структуру митохондриальных крист было исследовано в ответ на внутренний апоптотический стимул, в частности, на актиномицин D в высокой дозе [ 53 ] . Более того, bona fide эффект MIEF2 на апоптоз в значительной степени неуловим, и возможно, что комбинаторные функции MIEF2 и MIEF1 отличаются от самого MIEF1. Очевидно, что необходимо больше узнать о сложном механизме интеграции митохондриальной динамики и BAX-опосредованного апоптоза в отсутствие экзогенных стрессоров.

Гипотетическая модель MIEF1, регулирующего клеточный гомеостаз посредством BAX-опосредованной гибели клеток и PINK1-PRKN-зависимой митофагии.

В дополнение к нашим выводам о том, что недостаток MIEF1 нарушает митохондриальное дыхание, мы уточняем, что потеря MIEF1 автономно запускала митохондриальный окислительный стресс по PRKN-специфическому пути, предпочтительно благоприятствуя PINK1-PRKN-опосредованной элиминации митохондрий посредством аутофагии. Хотя сообщалось, что подавление MIEF1 с помощью РНК, вмешивающейся в клетки COS7, ингибирует PINK1-PRKN-зависимую митофагию [ 64 ], несоответствие между ними может быть вызвано специфическими ответами между разными типами клеток.Кроме того, наш вывод о том, что митофагия была спровоцирована потерей MIEF1 в клетках HeLa, стабильно экспрессирующих GFP-PRKN при лечении CCCP, дополняет анализы, применяемые с дополнительными митохондриальными токсинами, включая ОА и валиномицин, в то время как клиренс деполяризованных митохондрий, опосредованных CCCP, был специально изучен. в клетках COS7 из предыдущего исследования. Альтернативно, «сверхпродуцирование PRKN» в клетках COS7 осуществляли с помощью временной трансфекции [ 64 ]. Однако по сравнению с нашими данными, полученными на клетках HeLa, стабильно экспрессирующих PRKN, различия в уровнях PRKN также, возможно, могут объяснять несоответствие.

В текущем исследовании мы предлагаем модель, в которой MIEF1 регулирует рекрутирование PRKN на деполяризованные митохондрии и управляет убиквитинизацией и деградацией MFN2 и FIS1 для митофагии. Мы показываем, что потеря MIEF1, в частности, инициирует транслокацию PRKN после кратковременного воздействия CCCP и дополнительно ускоряет деградацию MFN2 и FIS1 через путь UPS, положительно регулируя выведение митохондрий. Напротив, высокий уровень MIEF1 управляет рекрутированием PRKN и защищает клиренс митохондриальных белков, скорее всего, посредством прямых физиологических взаимодействий между MIEF1 и MFN2 или MIEF1 и FIS1 при снижении потенциала митохондриальной мембраны.Таким образом, мы демонстрируем, что уровень MIEF1, но не MIEF2, является критическим для механизма прямой связи PINK1-PRKN-опосредованной митофагии.

Было обнаружено представление о том, что MFN2, как связка митохондрий-ER, негативно регулирует митофагию, опосредованную PINK1-PRKN [ 59 ]. Несмотря на то, что большое количество работ выяснило механистические детали опосредованной PINK1-PRKN митофагии в ответ на деполяризацию, вызванную CCCP [ 35 - 37 , 40 ], оставался открытым вопрос, реагируют ли клетки по-разному во время отчетливые этапы развития митофагии.Поразительно, насколько нам известно, наши находки здесь впервые обеспечивают дополнительное понимание MFN2 в дифференциальной регуляции митофагии, опосредованной PINK1-PRKN, на ранних и поздних стадиях. Наши результаты подтверждают, что MFN2, в раннем начале митохондриальной деполяризации, блокирует митофагию посредством управления связкой митохондрии-ER [ 59 ]. Кроме того, мы обнаружили, что MFN2 на поздней стадии лечения CCCP жизненно важен для митофагии. В частности, деградация MFN2 через путь UPS запускает митофагию.Примечательно, что оборот MFN2 запускается потерей MIEF1, подтверждая ключевую функцию MIEF1 в PINK1-PRKN-опосредованной митофагии.

Кроме того, что касается роли FIS1 в митофагии, наши наблюдения совпадают с предыдущими открытиями FIS1 по PINK1-PRKN-зависимой митофагии, в которой низкие уровни FIS1 отменяют митофагию [ 44 , 65 ]. Однако в нашем исследовании UPS-опосредованная регуляция FIS1 сильно выражена, проливая свет на дополнительный уровень понимания митофагии.В грубом приближении было высказано предположение, что деление митохондрий способствует митофагии, которая требует уменьшения размера митохондрий, пригодных для аутофагосомного поглощения. Напротив, удлинение митохондрий защищает клетки от митофагии [ 66 , 67 ]. Однако, что касается этой проблемы, здесь мы проиллюстрируем, что сенсибилизация MIEF1 дефицита к митофагическому пути, опосредованному PINK1-PRKN, вероятно, не зависит от митохондриальной динамики, на основании того, что аналогичные эффекты не наблюдались, когда мы заглушали MIEF2 или DNM1L .Более того, слитые митохондрии действительно обнаруживаются в MIEF1 -истощенных клетках. Таким образом, наши данные подтверждают предположение, что MIEF1 регулирует контроль качества митохондрий по пути, отличному от его роли в морфологии митохондрий. Более глубокое понимание того, как оборот MFN2 и FIS1, но не других белков OMM, способствует прогрессированию митофагии, требует дальнейшего изучения.

Подводя итог, наше исследование раскрывает важность MIEF1 как связующего звена, объединяющего BAX-опосредованную гибель клеток и PINK1-PRKN-зависимую митофагию путем включения различных механизмов ответа ( Рисунок 9 ).Как привратник митохондриального гомеостаза, MIEF1 управляет и защищает митохондрии от приверженности апоптозу или митофагии. Неожиданная роль M1EF1 в митохондриальном гомеостазе иллюстрирует дальнейшее понимание клеточных ответов помимо митохондриальной динамики. Следует отметить, что MIEF1 может работать по нескольким механизмам, вызывая митохондриальную дисфункцию или взаимодействуя со специфическими белками OMM, такими как BCL2L1 и FIS1, но доказательства объединяющего механизма, объясняющего все известные эффекты MIEF1, все еще нуждаются в дальнейшем установлении, включая точные роль MIEF1 на пересечении апоптоза и митофагии.Следовательно, наша иллюстрация здесь о роли MIEF1 как в гибели клеток, так и в митофагии, вероятно, будет стимулировать лучшую перспективу связывания этих двух. Более глубокое понимание влияния белков OMM на тонкую настройку митохондриального поведения позволит лучше понять митохондриальный гомеостаз. Дальнейшие исследования того, как дисрегуляция MIEF1 в клеточной гибели или парадигма PINK1-PRKN-опосредованной митофагии участвует в патологиях болезней, таких как рак и нейродегенеративные заболевания, еще предстоит прояснить.

Материалы и методы

Антитела

Анти-BAK1 (Sigma-Aldrich, B5897), анти-BAX (Santa Cruz Biotechnology, sc-493), анти-BCL2 (Santa Cruz Biotechnology, sc-7382), анти-BCL2L1 (Santa Cruz Biotechnology, sc-8392), анти-расщепленный CASP7 (Asp198, D6h2; Cell Signaling Technology, 8438), анти-расщепленный PARP (Asp214, D64h20; Cell Signaling Technology, 5625), анти-CYCS (BD Bioscience, 556433 ), анти-DIABLO (Abcam, ab32023), анти-DNM1L (BD BioScience, 611112), анти-FIS1 (GeneTex, 111010), анти-FLAG (Sigma-Aldrich, F3165), анти-GAPDH (Santa Cruz Biotechnology, sc -47724), анти-GFP (Santa Cruz Biotechnology, sc-9996), анти-HSPD1 (Santa Cruz Biotechnology, sc-1052), анти-MFF (Abcam, 139026), анти-MFN1 (Santa Cruz Biotechnology, sc-50330 ), анти-MFN2 (Santa Cruz Biotechnology, sc-100560), анти-MIEF1 (Proteintech, 20164–1-AP), анти-MIEF2 (Proteintech, 16413–1-AP), анти-MT-CO2 (Abcam, ab79393 ), анти-MYC (Sigma Aldrich, C3956), анти-p-BCL2 (Ser 87; Santa Cruz Biotechnology , sc-16323-R), анти-TIMM23 (BD ​​BioScience, 611222), анти-TOMM20 (Santa Cruz Biotechnology, sc-17764), анти-TUBB (Sigma-Aldrich, T2200), анти-убиквитин (Santa Cruz Biotechnology, sc-8017) и анти-VDAC1 (Santa Cruz Biotechnology, sc-8828).

Плазмиды

Mief2 -MYC (Mus musculus; 4596, лаборатория Дэвида Чана) и Mief1 -MYC (Mus musculus; 44598, лаборатория Дэвида Чана) были приобретены у Addgene. MIEF1 -GFP был любезно предоставлен доктором Майклом Т. Райаном (Университет Монаша, Австралия), а затем субклонирован в вектор c-Flag pcDNA3 (Addgene, 20011, лаборатория Стивена Смейла). MYC- BAX , MYC- BCL2L1 , MYC- DNM1L K38A , Mfn1 -MYC и Mfn2 -MYC были любезно предоставлены доктором.Виктор Чун-Конг Ю (Национальный университет Сингапура, Сингапур), а затем субклонированный в векторы Flag-pXJ 40, mCherry-pXJ40 или GFP-pXJ40 (любезные подарки от доктора Лоу Бун Чуана, Национальный университет Сингапура, Сингапур). GFP- PRKN был любезно предоставлен доктором Ках-Леонг Лим (Национальный университет Сингапура, Сингапур) и субклонирован в MYC-pXJ 40 (любезный подарок от доктора Лоу Бун Чуан, Национальный университет Сингапура, Сингапур).

РНК-интерференция

Олигонуклеотиды для миРНК были синтезированы Sigma-Aldrich.

Контрольная миРНК: 5ʹ -UUCUCCGAACGUGUCACGU- 3ʹ; DNM1L миРНК: 5ʹ - UUCAAUCCGUGAUGAGUAUGCUUUUCUUC - 3ʹ; FIS1 миРНК: 5ʹ -AACGAGCUGGUGUCUGUGGAG-3ʹ; MFF миРНК: 5ʹ -AACGCUGACCUGAACAAGGA- 3ʹ; MFN1 миРНК: 5ʹ -CUUCCUAAGUGUUGAAGGA- 3ʹ; MFN2 миРНК: 5ʹ - GUGAUGUGGCCCAACUCUA-3ʹ; MIEF1 миРНК # 1: 5ʹ - GCCAAGCAAGCUGCUGUGGACAUAU-3ʹ; MIEF1 siRNA # 2: 5ʹ - GAGAAACUUCUUACUUACUACCGGA-3ʹ; MIEF2 миРНК: 5ʹ - ACUUUCGGAGCAAGUUCCCGGAACU-3ʹ; PINK1 миРНК: 5ʹ -GACGCUGUUCCUCGUUAUGAA- 3ʹ.

Культура клеток, трансфекция и лечение

Клетки

HeLa (ATCC® CCL-2 ™) и HEK 293T (ATCC® CRL-11268 ™) были приобретены в ATCC. Клетки HeLa, стабильно экспрессирующие GFP-PRKN Клетки HeLa были любезно предоставлены доктором Ках-Леонг Лим (Национальный университет Сингапура, Сингапур). Клетки HeLa, стабильно экспрессирующие HA-PRKN, были любезным подарком от доктора Бинь Сяо из группы доктора Энг-Кинга Тана (Национальный институт неврологии, Сингапур). Клетки HeLa, стабильно экспрессирующие YFP-PRKN и mt-mKeima, были любезно поддержаны доктором.Ричард Дж. Юл (Секция биохимии, отделение хирургической неврологии, Национальный институт неврологии, США). Среда Игла, модифицированная Дульбекко (DMEM) (Sigma-Aldrich, D5648) с добавлением 10% (об: об) фетальной бычьей сыворотки (FBS) (GE Healthcare Hyclone, SV30160.03), была использована для культивирования клеток при 37 ° C ниже 5%. СО2.

Липофектамин 2000 TM (Thermo Fisher Scientific, 11668019) и полиэтиленимин (PEI; Sigma-Aldrich, 408727) методы были использованы для трансфекции миРНК или плазмид в клетки HeLa при 70% слияниях в соответствии с инструкциями производителя.

Стауроспорин (Sigma-Aldrich, S6942), актиномицин D (Thermo Fisher Scientific, 11–805-017), CCCP (Sigma-Aldrich, C2759), CHX (Sigma-Aldrich, C7698), олигомицин (Merck Millipore, 495455) , антимицин A (Sigma-Aldrich, A1410), валиномицин (Sigma-Aldrich, V0627), Q-VD-OPH (Sigma-Aldrich, SML0063) и PI (Thermo Fisher Scientific, BMS500PI) использовали в указанных дозах. MitoTracker Red CMXRos (Thermo Fisher Scientific, M7512) использовали в конечной концентрации 100 нМ. TMRM (тетраметилродамин; Thermo Fisher Scientific, T668) использовали в конечной концентрации 100 нМ.MitoSOX TM (Thermo Fisher Scientific, {"type": "entrez-нуклеотид", "attrs": {"text": "M36008", "term_id": "214108", "term_text": "M36008"}} M36008) в конечной дозе 5 мкМ. BMH (Thermo Fisher Scientific, 22330) использовали в конечной концентрации 2 мМ. Для исследований транслокации PRKN использовали CCCP в конечной дозе 5 мкМ в течение 1,5 часов, тогда как для определения митофагии CCCP использовали при 10 мкМ в течение 16 часов.

Иммуноблоттинг и иммунопреципитация

Клетки собирали и лизировали в буфере RIPA (50 мМ HEPES [1st BASE, BIO-1825], pH 7.4, 150 мМ NaCl [1st BASE, BIO-1110], 1% NP-40 [Sigma-Aldrich, 74385], 0,1% SDS [1st BASE, BIO-2050], 0,25% дезоксихолат натрия [Fluka, 30970], 1 мМ ЭДТА [1st BASE, BIO-1050], с добавлением ингибиторов протеаз, включая 10 мкг / мл апротинина [Thermo Fisher Scientific, 78432], 1 мМ фенилметилсульфонилфторид [Sigma-Aldrich, P7626], 1 мкМ пепстатин A [MP Biomedicals, 0219536880] и 10 мкМ лейпептина [MERCK Millipore, E18]). Образцы кипятили с буфером, содержащим SDS, при 95 ° C в течение 10 минут, а затем разделяли с помощью SDS-PAGE и проводили иммуноблоттинг.Изображения были получены с помощью Amersham Imager 600 (GE Healthcare Life Sciences, Сингапур).

Для иммунопреципитации клетки временно трансфицировали указанными плазмидами с использованием метода полиэтиленимина (PEI) в течение 24 часов. Клетки собирали и лизировали в 1 мл буфера для лизиса NP-40 (50 мМ Tris-HCl [1st BASE, BIO-1500], pH 7,4, 150 мМ NaCl, 10 мМ пирофосфата натрия [1st BASE, BIO-1542], 2 мМ EDTA и 5% NP-40, дополненный ингибиторами протеаз, включая 10 мкг / мл апротинина, 1 мМ фенилметилсульфонилфторид, 1 мкМ пепстатин A и 10 мкМ лейпептин) на льду в течение 10 минут и центрифугировали при 21130 × g в течение 20 минут при 4 ° С.Гранулы FLAG M2 (Sigma-Aldrich, A2220) инкубировали с осветленными лизатами при 4 ° C в течение 3 часов. После инкубации иммунные комплексы промывали 3 раза буфером для лизиса NP-40 и белки, конъюгированные с гранулами, денатурировали в загрузочном буфере 2 × SDS в течение 15 мин при 95 ° C. Затем образцы разделяли с помощью SDS-PAGE и детектировали иммуноблоттингом.

Субклеточное фракционирование

Для экстракции митохондриальных мембран клетки, культивированные в 10-сантиметровых чашках, промывали PBS (137 мМ NaCl, 2.7 мМ KCl [1-я ОСНОВА, BIO-1300], 8 мМ Na 2 HPO 4 [1-я ОСНОВА, BIO-1540] и 2 мМ KH 2 PO 4 [1-я ОСНОВА, BIO-1200] ) и собирали, используя предварительно охлажденный буфер для экстракции митохондрий 1 (220 мМ D-маннит [Sigma-Aldrich, M4125], 70 мМ сахароза [1st BASE, BIO-1090], 20 мМ HEPES-KOH [Sigma-Aldrich, P5958]. , pH 7,5, 1 мМ EDTA, 0,5 мМ фенилметилсульфонилфторид, 2 мг / мл BSA [Sigma-Aldrich, A2153], с добавлением ингибиторов протеаз, включая 10 мкг / мл апротинина, 1 мкМ пепстатина A и 10 мкМ лейпептина).Клетки пропускали через шприц 25-G 20 раз на льду. Гомогенизированные клетки центрифугировали при 1000 × g в течение 15 мин при 4 ° C. Затем супернатант центрифугировали при 10000 × g в течение еще 10 мин при 4 ° C для осаждения митохондрий. Фракцию супернатанта оставили как цитозольную фракцию. Осадки митохондрий ресуспендировали в буфере RIPA, а затем подвергали SDS-PAGE и иммуноблоттингу [ 68 ].

Иммунофлуоресценция, флуоресцентная микроскопия и получение изображений с микроскопа

4% параформальдегид (Sigma-Aldrich, P6148) в PBS использовали для фиксации клеток при комнатной температуре в течение 10 минут, после чего клетки промывали 3 раза PBS, пермеабилизировали и заблокирован в 3% BSA в PBS, содержащем 0.2% Triton X-100 (Sigma-Aldrich, X100) в течение 1 часа. Первичные антитела разводили в 3% BSA для инкубации в течение ночи. Клетки промывали PBS и затем инкубировали с вторичными антителами, конъюгированными с Alexa Fluor (Thermo Fisher Scientific, Alexa Fluor® 488, A-11001 или A-11034; Alexa Fluor® 568, A-11004 или A-11011; Alexa Fluor® 633 , А-21052 или А-21071). Ядро метили Hoechst 33342 (Thermo Fisher Scientific, h4570) при комнатной температуре в течение 10 мин. Затем покровные стекла устанавливали на предметные стекла с помощью FluorSave TM (Calbiochem, 345789–20).

Конфокальные изображения были получены с помощью лазерного сканирующего конфокального микроскопа (Olympus FV3000, Центр наук о биоизображении, Национальный университет Сингапура) через объектив 63 ×, 1,4 NA или микроскоп с вращающимся диском (VolocityTM [PerkinElmer], Центр наук о биоизображении , Национальный университет Сингапура) через объектив 100 ×, 1,4 NA, используя длины волн возбуждения 405, 488, 561 или 640 нм. Визуализацию живых клеток проводили в камере при 37 ° C с 5% CO2.

Анализ проточной цитометрии

Клетки предварительно обрабатывали 10 нМ TMRM или 5 мкМ MitoSOX TM в течение 15 мин, после чего клетки трипсинизировали и ресуспендировали в PBS.Проточную цитометрию выполняли с использованием BD LSR Fortessa или Cytoflex LX (Медицинская школа Йонг Лу Лин, Национальный университет Сингапура), а результаты анализировали с использованием Summit TM 4.3 или CytExpert 2.1 соответственно. Для каждого эксперимента было зарегистрировано 10 000 событий, и показанные результаты являются репрезентативными для 3 независимых экспериментов.

Для мечения PI плавающие и прикрепленные клетки собирали после обработки STS, промывали PBS и фиксировали в 70% этаноле (Sigma-Aldrich, 16368) при -20 ° C в течение 1 часа.ДНК окрашивали 50 мкг / мл PI в PBS, содержащем 100 мкг / мл РНКазы A (Thermo Fisher Scientific, EN0531). Проточную цитометрию выполняли с использованием BD LSR Fortessa или Cytoflex LX, а результаты анализировали с помощью Summit 4.3 или CyExpert. Для каждого эксперимента было зарегистрировано 10 000 событий, и показанные результаты являются репрезентативными для 3 независимых экспериментов.

Для анализа митофагии на основе mt-mKeima клетки HeLa, стабильно экспрессирующие mt-mKeima и YFP-PRKN, трансфицировали контролем или миРНК MIEF1 в течение 48 часов.Клетки дополнительно обрабатывали CCCP, как указано. Клетки собирали и анализировали для проточной цитометрии, ссылаясь на предыдущие отчеты [ 46 , 69 ].

Анализ морского конька

Скорость потребления кислорода (OCR) измеряли с использованием оборудования Seahorse XF96 (Seahorse Bioscience Inc., Институт молекулярной и клеточной биологии, Сингапур). Клетки HeLa (25000 на лунку) высевали за 24 ч до измерения. Планшеты с клетками уравновешивали в инкубаторе без CO2 при 37 ° C в течение 1 часа.Затем вводили олигомицин (1 мкМ; Agilent, 103015–100), CCCP (0,5 мкМ; Sigma-Aldrich, C2759), ротенон (1 мкМ; Agilent, 103015–100) и антимицин (1 мкМ; Agilent, 103015–100). в ячейки в указанные моменты времени.

Статистический анализ

Для количественной оценки значения были получены в 3 независимых экспериментах, представленных как среднее ± стандартное отклонение. Статистические данные обрабатывали в программе GraphPad Prism или Excel. Анализы рассчитывались с использованием двустороннего непарного теста Стьюдента t .* P <0,05, ** P <0,01 и *** P <0,001 считались значимыми.

Микробелок MIEF1 регулирует трансляцию митохондрий

Abstract

Последние технологические достижения привели к открытию от сотен до тысяч пептидов и малых белков (микробелков), кодируемых небольшими открытыми рамками считывания (smORF). Характеристика новых микропротеинов демонстрирует их роль в фундаментальных биологических процессах и подчеркивает ценность открытия и характеристики большего количества микропротеинов.Выяснение микробелковых взаимодействий (MPI) полезно для определения биохимической и клеточной роли микробелков. В этом исследовании мы охарактеризовали партнеров по взаимодействию с белками микробелка фактора элонгации 1 митохондрий (MIEF1-MP), используя стратегию метки близости, основанную на APEX2. MIEF1-MP локализуется в митохондриальном матриксе, где он взаимодействует с митохондриальной рибосомой (миторибосомой). Функциональные исследования демонстрируют, что MIEF1-MP регулирует трансляцию митохондрий посредством его связывания с миторибосомой.Потеря MIEF1-MP снижает скорость трансляции митохондрий, в то время как повышенный уровень MIEF1-MP увеличивает скорость трансляции. Идентификация MIEF1-MP выявляет новый ген, участвующий в этом процессе.

Ключевые слова: MIEF1, микропротеин, MIEF1-MP, митохондриальная трансляция, APEX2, взаимодействие микробелков и белков.

ВВЕДЕНИЕ

Малые открытые рамки считывания (smORF), кодирующие белок, представляют собой группу недостаточно изученных генов, играющих фундаментальную роль в биологии. 1, 2 Большинство smORF не аннотированы, потому что алгоритмы поиска генов требуют минимальной длины для присвоения генов. 3 Около половины всех аннотированных smORF расположены выше более длинных открытых рамок считывания (ORF) 4 , где они функционируют как цис-регуляторы трансляции белков - в большинстве случаев присутствие расположенной выше ORF (uORF) снижает трансляцию нисходящий ORF. 4 Однако открытие от сотен до тысяч ранее не аннотированных smORF и микробелков, которое произошло благодаря достижениям в области вычислений, 5–8 геномных, 9–13 и протеомных 7, 14–16 технологий, выявили множество smORFs, которые не являются uORFs.Эволюционная консервация показала, что некоторые из этих smORF будут преобразованы в функциональные микробелки, и недавние исследования в этой области подтвердили это мнение. 17–21

Функциональные исследования на мухах и млекопитающих, например, продемонстрировали, что по крайней мере некоторые из микробелков играют фундаментальную биологическую роль в развитии, метаболизме и функции мышц. 22–24 Нокаут гена без тарзального / полированного риса (Tal / Pri) у мух приводил к выраженным фенотипам развития. 25 Tal / Pri представляет собой полицистронную мРНК с четырьмя smORF, которые кодируют три 11-аминокислотных и один 32-аминокислотный микробелки, которые необходимы для собственно эмбриогенеза Drosophila . 23, 26 Последующие исследования микробелков Tal / Pri показали, что эти микропротеины связываются с убиквитин-лигазой Ubr3 у мух и способствуют ограниченному протеолизу и, таким образом, активации фактора транскрипции Shaven baby (Svb), управляющего дифференцировкой эпидермиса. 17, 18

У млекопитающих также есть биологически активные микробелки. 19–21, 27, 28 Например, миорегулин (MLN) представляет собой консервативный микропротеин, который кодируется специфическим для скелетных мышц транскриптом, который взаимодействует с катионным каналом SERCA, препятствуя захвату Ca 2+ в саркоплазматический ретикулум (SR ) и контролирует мышечную функцию. Удаление MLN у мышей усиливает обработку Ca 2+ в скелетных мышцах и улучшает выполнение упражнений in vivo , подчеркивая роль MLN как регулятора физиологии скелетных мышц. 19 CYREN представляет собой микропротеин млекопитающих, который взаимодействует с гетеродимером Ku70 / 80 для ингибирования подверженной ошибкам репарации ДНК во время фаз S и G2 клеточного цикла. 20, 21 Эти примеры подчеркивают важность изучения микробелков для понимания критических биологических процессов.

Здесь мы сосредоточены на молекулярной и биохимической характеристике uORF, расположенной в 5 ’UTR гена митохондриального динамического белка MID51 (MIEF1). MIEF1 регулирует деление митохондрий, 29 , и первоначальная характеристика uORF MIEF1, который кодирует микропротеин MIEF1 (MIEF1-MP), выявила митохондриальный микропротеин, который также участвует в делении митохондрий. 30 MIEF1-MP состоит из 70 аминокислот и был обнаружен протеомным анализом в нескольких клеточных линиях, включая клетки HEK293, HeLa и THP1, а также in vivo в ткани кишечника. 7, 31 Общедоступные данные профилирования рибосом также подтвердили трансляцию uORF MIEF1 в клетках HEK293, HeLa, PC3 и THP1. 32 MIEF1-MP эволюционно консервативен у позвоночных и содержит мотив LYR. Мотив LYR обнаружен в 11 белках млекопитающих, и шесть из них взаимодействуют с механизмом митохондриального дыхания. 33–37 Другие участвуют в кластерном биогенезе Fe-S (LYRM4), 38 передаче сигналов инсулина (LYRM1), 39 комплекс I филогенетический профиль COPP (LYRM5), 37 или имеют неизвестные функции. 40 Предыдущая работа показывает, что MIEF1-MP способствует делению митохондрий с использованием домена LYR, поскольку мутанты LYR были неактивными. 30 Одно предостережение в этих функциональных исследованиях состоит в том, что они полагаются на сверхэкспрессию MIEF1-MP, и в этом исследовании мы наблюдаем, что сверхэкспрессия приводит к обнаружению нефункциональных взаимодействий MIEF1-MP-белок.

Мы использовали биохимический подход для идентификации белок-интеракторов MIEF1-MP с использованием метода близости in vivo , который основан на сконструированном белке APEX2 (APEX). 41, 42 Используя этот подход, мы обнаружили, что MIEF1-MP взаимодействует с митохондриальной рибосомой (миторибосомой). Митохондриальный геном кодирует 38 генов: 14 кодирующих белков, 22 для митохондриальной тРНК и 2 для митохондриальной рРНК. Миторибосома транслирует несколько кодируемых митохондриями мРНК с образованием 13 субъединиц респираторных комплексов I, III, IV и V. 43 Мы измерили уровни вновь синтезированных белков, кодируемых митохондриями, и обнаружили, что MIEF1-MP является регулятором митохондриальной трансляции. Потеря MIEF1-MP снижает скорость глобальной митохондриальной трансляции, в то время как повышенные уровни MIEF1-MP увеличивают скорость вновь синтезированных митохондриальных белков. Эти результаты показывают, что MIEF1-MP является новым геном, участвующим в регуляции митохондриальной трансляции.

МАТЕРИАЛЫ И МЕТОДЫ

Иммунофлуоресценция и конфокальная визуализация

Клетки HeLa высевали на покровное стекло (Fisher Scientific, # 12-541-B) в шестилуночный планшет, предварительно обработанный 50 мкг / мл поли-L- лизин (Sigma, # P1399).На следующий день клетки трансфицировали 1 мкг C-концевого FLAG-меченного микробелка MIEF1 (MIEF1-MP-FLAG) или C-концевого APEX-MYC-меченного MIEF1-MP (MIEF1-MP-APEX-MYC) плазмиды с использованием липофектамина 2000. Через 48 часов после трансфекции клетки фиксировали 4% параформальдегидом (Polysciences, Inc., # 18814) и повышали проницаемость с помощью 0,1% сапонина (Alfa Aesar, # A18820). После инкубирования с 4% BSA в фосфатно-солевом буфере (PBS) в течение 1 часа при комнатной температуре клетки окрашивали первичными антителами (мышиные анти-FLAG и кроличьи антитела против TOM20 или кроличьи антитела против MYC и мышиные антитела против TOM20) при Разведение 1: 1000 в течение ночи при 4 ° C.Клетки промывали трижды PBS с последующей инкубацией со вторичными антителами (козлиные антимышиные Alexa Fluor 488 и козлиные антикроличьи Alexa Fluor 546 или козлиные антикроличьи Alexa Fluor 488 и козьи антимышиные Alexa Fluor 546, 1: 500 в PBS) в течение 1 часа при комнатной температуре. Ядра контрастировали с помощью Hoechst 33258 (Sigma, # 94403; 1: 2000 в PBS). После трех промывок PBS покровное стекло закрывали с помощью Prolong Gold Antifade Mountant (Life Technologies, # {"type": "entrez-protein", "attrs": {"text": "P36930", "term_id": "1248281091") , "term_text": "P36930"}} P36930) и проанализированы с помощью конфокальной визуализации с использованием лазерного сканирующего конфокального микроскопа Zeiss LSM 710 с иммерсионным объективом 63x.Изображения были проанализированы с помощью программного обеспечения FIJI.

Анализ защиты протеиназы К для субмитохондриальной локализации буфер (225 мМ маннитол 75 мМ сахароза 50 мМ NaHEPES pH 7,4 с добавлением коктейльной таблетки полного ингибитора протеазы Roche), гомогенизировали и центрифугировали для выделения различных клеточных фракций

44 .Выделенный осадок митохондрий промывали трижды и затем суспендировали в буфере для изоляции, 2 мМ HEPES или 0,3% Triton X-100 с последующим добавлением протеиназы К для отбора образцов. После 30 минут инкубации на льду добавляли 1 мМ фенилметансульфонилфторид (PMSF) для гашения протеазы и добавляли трихлоруксусную кислоту (TCA, конечная концентрация 12%) для осаждения образцов, которые затем промывали ацетоном. Осадки растворяли в красителе с 2-кратной загрузкой SDS, разделяли электрофорезом в полиакриламидном геле с додецилсульфатом натрия (SDS-PAGE) и анализировали вестерн-блоттингом с использованием указанных антител.

Коиммунопреципитация

FLAG-меченных микробелковых конструкций или пустой вектор pcDNA3.1 (+) трансфицировали в 10-сантиметровую чашку с клетками HEK293T с использованием липофектамина 2000 в соответствии с протоколом производителя. Через 24 часа после трансфекции клетки собирали и лизировали в IP-буфере для лизиса (ThermoFisher, # 87787) с добавлением коктейльной таблетки полного ингибитора протеазы Roche и 1 мМ PMSF. Клетки лизировали на льду в течение 10 минут с последующим центрифугированием при 20 000 g в течение 20 минут при 4 ° C для удаления остатков клеток.Лизаты клеток добавляли к предварительно промытым шарикам агарозы мышиного IgG (Sigma, # A0919) и вращали при 4 ° C в течение 1 часа. Супернатанты собирали и добавляли в предварительно промытый аффинный гель против FLAG M2 (Sigma, # A2220). Суспензии вращали при 4 ° C в течение 2 часов и трижды промывали TBST. Связанные белки элюировали пептидом 3 × FLAG (Sigma, # F4799) при 4 ° C в течение 1 часа.

Мечение биотин-фенолом в живых клетках и уменьшение количества стрептавидина

Мечение биотин-фенолом в живых клетках выполняли согласно ранее опубликованным протоколам. 41, 45 Вкратце, конструкции, содержащие слитые белки MIEF1-MP-APEX или APEX (контрольный образец), трансфицировали в клетки HEK293T с использованием липофектамина 2000. Через 24 часа после трансфекции среду для культивирования клеток заменяли на свежую среду для выращивания, содержащую 500 мкМ биотин-тирамида (CDX-B0270, Adipogen). После инкубации при 37 ° C в течение 30 минут в каждый планшет добавляли H 2 O 2 до конечной концентрации 1 мМ, и планшеты осторожно встряхивали в течение 1 минуты. Затем клетки трижды промывали гасящим раствором (5 мМ Trolox, 10 мМ азида натрия и 10 мМ аскорбата натрия в PBS) и осаждали центрифугированием при 1000 g в течение 5 мин.Осадки клеток лизировали на льду в течение 20 минут в буфере RIPA (номер в каталоге Thermo 89901) с добавлением коктейльной таблетки полного ингибитора протеазы Roche и 1 мМ PMSF с последующим центрифугированием при 20000 g в течение 20 минут при 4 ° C для удаления остатков клеток. Лизаты клеток добавляли к предварительно промытой стрептавидиновой агарозной смоле (ThermoFisher, # 20359), вращали при 4 ° C в течение ночи, а затем трижды промывали TBST и 0,5% (об. / Об.) Додецилсульфатом натрия (SDS) при комнатной температуре. Связанные белки элюировали 2 × SDS кипячением при 95 ° C и анализировали протеомикой и вестерн-блоттингом.

Протеомный анализ коиммунопреципитации и маркировка биотин-фенолом

Для протеомики элюированные образцы осаждали трихлоруксусной кислотой (TCA, MP Biomedicals, # 196057) в течение ночи при 4 ° C или с использованием метанол-хлороформа. Высушенные гранулы растворяли в 8 М мочевине, восстанавливали 5 мМ трис (2-карбоксиэтил) фосфин гидрохлорид (TCEP, ThermoFisher, # 20491) и алкилировали 10 мМ йодацетамидом (Sigma, # I1149). Затем белки переваривали в течение ночи при 37 ° C трипсином (Promega, # V5111).Реакцию гасили муравьиной кислотой до конечной концентрации 5% (об. / Об.). Расщепленные образцы анализировали на масс-спектрометре Q Exactive Hybrid Quadrupole-Orbitrap.

Метаболическое маркирование продуктов трансляции митохондрий с использованием AHA

Клетки HEK293T трансфицировали MIEF1-MP-FLAG (1 мкг на лунку) в течение 24 часов или миРНК MIEF1 (100 пмоль) в течение 72 часов в трех экземплярах с соответствующими контрольными векторами pcDNA и отрицательными миРНК. Аналогичным образом, для эксперимента по спасению клетки 293T обрабатывали миРНК MIEF1 (100 пмоль) в течение 48 часов, а затем вектором pcDNA или MIEF1-MP-FLAG (1 мкг на лунку) в течение 24 часов в трех повторностях.Затем было выполнено импульсное маркирование продуктов трансляции митохондрий в соответствии с описанным протоколом с модификациями 46 . В частности, клетки при 80% конфлюэнтности инкубировали со 100 мкМ AHA в буфере HBS, содержащем 100 мкг / мл ингибитора цитозольной трансляции эметина, в течение 3 часов. После маркировки AHA клетки лизировали, нормализовали и проводили реакцию «щелчок» путем инкубации клеточных лизатов с алкином, конъюгированным с IRDye800® (LI-COR, # 929-60002), в течение 3 часов при комнатной температуре.Белки осаждали TCA, промывали ледяным ацетоном и сушили на воздухе перед разделением в SDS-PAGE с использованием геля Bolt 4–12% Bis-Tris Protein Gel (Invitrogen). Гель визуализировали, а изображения анализировали с помощью LI-COR Odyssey CLx.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Микропротеин MIEF1 транслируется из smORF выше гена MIEF1

MIEF1 представляет собой белок внешней митохондриальной мембраны, который регулирует динамику митохондриальной мембраны. MIEF1 взаимодействует с Drp1 и Mff в тримерном комплексе, чтобы регулировать Mff-индуцированное накопление Drp1.Избыточная экспрессия MIEF1 изолирует Drp1 на внешней митохондриальной мембране и способствует слиянию и удлинению митохондрий. Нокдаун MIEF1 приводил к делению и фрагментации митохондрий. 47, 48

Недавно белок-кодирующий smORF был идентифицирован в области 5 ’UTR гена MIEF1, который продуцирует микробелок MIEF1 (MIEF1-MP). В настоящее время нет антител к MIEF1-MP, поэтому нам нужно было убедиться, что они экспрессируются в клетках HEK293T, которые мы использовали.Профилирование рибосом (Ribo-Seq) - это метод отпечатка рибосом, который идентифицирует транслируемые области транскриптома. Анализ общедоступных данных HEK293T Ribo-Seq указывает на трансляцию MIEF1-smORF (), и наши протеомические данные подтвердили этот результат путем обнаружения триптического пептида «YTDRDFYFASIR» из MIEF1-MP (). MIEF1-MP представляет собой микробелок длиной 70 аминокислот, который сохраняется у людей и рыбок данио (). Предыдущая работа указала на роль MIEF1-MP в делении митохондрий. 30 Здесь мы стремились получить молекулярное понимание биохимии MIEF1-MP и использовать эту информацию для объяснения или прогнозирования функции MIEF1-MP.

Экспрессия и сохранение MIEF1-MP. (A) MIEF1-MP кодируется вышестоящим smORF (uORF) в мРНК MIEF1. Данные RNA-Seq (пурпурный) и Ribo-Seq (зеленый) из клеток HEK293T указывают на трансляцию MIEF1-MP smORF и MIEF1 (ORF). (B) Триптический пептид микробелка MIEF1, обнаруженный методом дробовидной масс-спектрометрии, подтверждает, что MIEF1-MP является стабильным членом протеома. (C) Выравнивание последовательностей MIEF1-MP демонстрирует, что этот микробелок консервативен у многих видов на уровне белка.

Микропротеин MIEF1 располагается в митохондриальном матриксе

Митохондрии - важные органеллы, обнаруженные в клетках млекопитающих и эукариотах. Митохондрии - это клеточные электростанции, которые производят более 60% АТФ в клетке посредством пути окислительного фосфорилирования митохондрий (OXPHOS). OXPHOS требует пяти мультибелковых комплексов во внутренней митохондриальной мембране, состоящих из белков, кодируемых ядерным и митохондриальным геномами.Помимо производства энергии, митохондрии выполняют дополнительные функции, например, опосредуют запрограммированную гибель клеток (апоптоз). 49, 50 Наша цель в этом исследовании - понять митохондриальные пути, регулируемые MIEF1-MP.

Анализ последовательности MIEF1-MP с помощью TargetP 51 предсказывает митохондриальную локализацию, а MitoFates 52 также предсказывает мотив узнавания TOM20 (аминокислоты 12–16 и 66–70). Временная экспрессия MIEF1-MP-FLAG приводит к локализации митохондрий (), демонстрируя, что эпитоп FLAG не нарушает локализацию MIEF1-MP. 30 Локализация MIEF1-MP-FLAG в митохондриях согласуется с предыдущими сообщениями, в которых использовалась микроскопия с более высоким разрешением для локализации GFP-tagged MIEF1-MP в митохондриальных сетях. 30

MIEF1-MP представляет собой микропротеин митохондриального матрикса. (A) MIEF1-MP-FLAG колокализуется с митохондриальным маркером TOM20 в клетках Hela, подтверждая его митохондриальную локализацию (ядерное окрашивание Hoechst (синий), TOM20 (красный), MIEF1-MP (зеленый), перекрытие желтого / оранжевого цветов). (B) Расщепление MIEF1-MP-FLAG протеиназой K имело сходный характер с HSP60, маркером митохондриального матрикса, что подтверждает его субклеточную локализацию в митохондриальном матриксе в клетках HEK293T.

Локализация MIEF1-MP в митохондриях неизвестна. Определение митохондриального расположения MIEF1-MP поможет понять его функцию. Мы использовали тест на защиту протеиназы К, который проверяет стабильность белка в условиях, которые избирательно проникают в митохондрии, чтобы определить, где находится белок между внешней или внутренней мембранами митохондрий или матрицей.Митохондрии выделяли из клеток 293T, экспрессирующих MIEF1-MP-FLAG, путем дифференциального центрифугирования для экспериментов по субклеточной локализации. 44 Выделенные митохондрии обрабатывали в трех условиях, которые дифференцированно регулируют доступ протеиназы К к субкомпартментам митохондрий. Добавление протеиназы К к митохондриям в изоляционном буфере разрушает маркер внешней мембраны митохондрий TOM20, но оставляет неизмененным TIM50, создатель внутренней митохондриальной мембраны и HSP60, маркер митохондриального матрикса (дорожка 2).Предварительная обработка митохондрий 2 мМ HEPES приводит к осмотическому набуханию и избирательному разрыву внешней митохондриальной мембраны, что приводит к деградации TIM50 (, дорожка 4), и солюбилизация митохондрий с помощью Тритона X-100 необходима для протеолиза HSP60 (, дорожка 6 ). Распад MIEF1-MP-FLAG в анализе протеиназы K имел идентичный паттерн с таковым для HSP60, что указывает на то, что MIEF1-MP является микробелком митохондриального матрикса.

Взаимодействия микробелков и белков MIEF1

MIEF1-MP содержит домен Complex1_LYR 40 , который определяется консервативной последовательностью трипептида LYR (лейцин / тирозин / аргинин), близкой к его N-концу, и нижележащим остатком F (фенилаланин) ( ).Геном человека содержит 11 белков, содержащих LYR, 8 из которых являются митохондриальными белками. 40 Большинство белков LYR представляют собой субъединицы (LYRM3 и LYRM6) или факторы сборки (LYRM7, LYRM8, ACN9 и FMC1) ядерных комплексов окислительного фосфорилирования (OXPHOS) в митохондриях. LYRM человека связаны с такими заболеваниями, как инсулинорезистентность (LYRM1), 39 мышечная гипотония (LYRM3), 53 дефицит множественных комплексов OXPHOS (LYRM4), 38 апоптоз при инфекции ВИЧ-1 (LYRM6), 54 энцефалопатия и лактоацидоз (LYRM7 / MZM1L), 34 инфантильная лейкоэнцефалопатия (LYRM8 / фактор сборки сукцинатдегидрогеназы (SDHAF) 1) 36 и алкогольная зависимость (не использующий ацетат 9) белок (ACFN3) / SDHAN. 35

MIEF1-MP содержит мотив LYR и взаимодействует с ACPM / NDUFAB1 при сверхэкспрессии. (A) График LOGO MIEF1-MP с известным мотивом LYR, содержащим белки, выделяет консервативный трипептид L-Y-R (лейцин / тирозин / аргинин) и нижестоящий мотив F (фенилаланин) (LYR и F). (B) Иммунопреципитация (IP) MIEF1-MP-FLAG обогащает ACPM / NDUFAB1, в то время как мутация LYR и F. в аланины отменяет это связывание. (C) Бесконтактное мечение с помощью MIEF1-MP-APEX-MYC демонстрирует обогащение ACPM / NDUFAB1 в живых клетках.

Некоторые из известных LYRM (LYRM3, LYRM4, LYRM6 и FMC1) взаимодействуют с ACPM / NDUFAB1, который является частью комплекса I, 33, 40, 55, 56 , и мы попытались определить, ассоциируется ли MIEF1-MP с ACPM. / NDUFAB1 через свой домен LYR. Мы провели иммунопреципитацию (IP) клеточных лизатов, сверхэкспрессирующих MIEF1-MP-FLAG или пустой вектор pcDNA (mock), с использованием антитела против FLAG, а затем проанализировали иммунопреципитаты с помощью протеомики. Мы обнаружили, что ACPM / NDUFAB1, обогащенный образцом со сверхэкспрессией MIEF1-MP-FLAG, по сравнению с ложным образцом ().Мы мутировали остатки LYR (лейцин / тирозин / аргинин) и нижестоящий F (фенилаланин) MIEF1-MP на аланины и повторили эксперимент с иммунопреципитацией-масс-спектрометрией и обнаружили, что взаимодействие MIEF1-MP: ACPM / NDUFAB1 требует мотива LYR () . Этот эксперимент убедил нас, что MIEF1-MP может участвовать в предсказанных межбелковых взаимодействиях, но мы всегда осторожны, чтобы не переоценивать эксперименты с лизатами со структурно неизвестными микробелками, потому что мы могли бы наблюдать ложные, неэндогенные взаимодействия.Мы провели эксперимент по метке близости с использованием слитого белка MIEF1-MP-APEX для получения релевантного для клеток взаимодействия, поскольку метка близости идентифицирует белковые комплексы в контексте живой клетки. 41, 45, 57 В этом подходе интересующий слитый белок APEX экспрессируется в клетках с последующей обработкой перекисью водорода (H 2 O 2 ) в присутствии биотин-фенола. H 2 O 2 способствует каталитическому окислению биотин-фенола под действием APEX с образованием высокореактивного биотин-феноксирадикала.Время жизни радикала составляет <1 мс, что ограничивает маркировку радиусом 20 нм. Это приводит к ковалентной маркировке белков, проксимальных к гибридному белку APEX, биотином, которые затем обогащаются и анализируются для идентификации белков-интеракторов in vivo . Перед проведением эксперимента по метке близости мы подтвердили, что MIEF1-MP-APEX-MYC локализуется в митохондриях с помощью иммунофлуоресценции (рисунок S1). Эксперименты по бесконтактной маркировке показывают, что ACPM / NDUFAB1 взаимодействует со слитым белком MIEF1-MP-APEX-MYC, но не с MIEF1mut-MP-APEX-MYC (LYR и F все мутированы в аланины), что согласуется с экспериментами по иммунопреципитации FLAG ().Вместе данные подтверждают, что сверхэкспрессированный MIEF1-MP взаимодействует с белком ACPM / NDUFAB1 через его мотив LYR.

ACPM / NDUFAB1 играет роль в биосинтезе липидов и активности респираторного комплекса 1, 58 , и это привело нас к гипотезе, что MIEF1-MP может влиять на эти пути в митохондриях. Однако мы не наблюдали никаких эффектов MIEF1-MP с использованием анализа активности митохондриального комплекса 1 (рисунок S2A) или биосинтеза липидов (рисунок S2B), что позволяет предположить, что взаимодействие MIEF1-MP: ACPM / NDUFAB1 не является функционально значимым.Одна проблема может возникнуть из-за того, что мы наблюдали эти белок-белковые взаимодействия в клетках, сверхэкспрессирующих MIEF1-MP, которые могут способствовать биологически нерелевантным взаимодействиям с более высокими концентрациями MIEF1-MP. Даже функциональная характеристика MIEF1-MP основана на сверхэкспрессии, поскольку нокдаун мРНК MIEF1 может приводить к нокдауну MIEF1-MP и MIEF1. Это привело нас к осознанию того, что нам нужна лучшая стратегия для поиска и проверки взаимодействий микробелков, особенно когда мы должны сверхэкспрессировать микробелки.

Биоинформатические реципрокные иммунопреципитации для обнаружения соответствующих взаимодействий MIEF1-MP

Мы провели поиск в протеомных данных экспериментов MIEF1-MP-APEX-MYC, чтобы определить, не пропустили ли мы другие потенциально значимые взаимодействия. Наш рабочий процесс информатики состоял из анализа данных с помощью анализа значимости INTeractome Express (SAINTexpress), 59 , который использует прогнозируемое распределение спектральных счетчиков для реального белок-белкового взаимодействия, чтобы отфильтровать ложные срабатывания, и репозитория загрязнителей для аффинной очистки (CRAPome ), 60 , который удаляет белки, которые многократно и неспецифически обогащаются в исследованиях взаимодействия белков.Применение SAINT и CRAPome к набору данных MIEF1-MP-APEX-MYC привело к получению 153 обогащенных белков со средним спектральным счетом больше или равным 5. Хотя наш список потенциальных взаимодействующих веществ значительно сокращен, проверка 153 белковых взаимодействий была бы сложной задачей. экспериментальная задача.

Реципрокная иммунопреципитация - золотой стандарт для проверки белок-белковых взаимодействий. Чтобы сделать это для 153 белков, потребуются антитела для каждого из белков и для человеческого MIEF1-MP, которых у нас нет и нет в продаже.Чтобы решить эту проблему, мы обратились к биоинформатическому подходу. Во-первых, мы использовали инструмент биоинформатики STRING 61 (), чтобы определить, какие из 153 белков, как известно, взаимодействуют друг с другом. Идея состоит в том, что идентификация множества белков из известных комплексов увеличивает уверенность в том, что MIEF1-MP участвует в законном межбелковом взаимодействии. Мы удалили обогащенные белки с менее или равным 2 взаимодействующим элементам (синглетоны или белки, которые не являются частью комплексов, содержащих более 3 белков) и идентифицировали пять кластеров связанных белков MIEF1-MP (кластеры с цветовой кодировкой).Пять кластеров включают комплексы, связанные с митохондриальной рибосомой, изоцитрат / сукцинат / малатдегидрогеназой, пируватдегидрогеназой, гидроксиацил-КоА-дегидрогеназой и цепью переноса электронов.

MIEF1-MP взаимодействует с миторибосомами. (A) Сеть взаимодействия белков, обогащенных в эксперименте MIEF1-MP-APEX-MYC после анализа STRING, выявляет белки, обогащенные MIEF1-MP, которые взаимодействуют друг с другом. (B) Спектральный подсчет для различных членов миторибосомы после эксперимента MIEF1-MP-APEX-MYC. (C) Вестерн-блот-проверка белок-белкового взаимодействия MIEF1-MP с некоторыми членами миторибосомы (MRPL4 и MRPL27) с помощью метки близости. В эксперименте использовалась экспрессионная конструкция MIEF1-MP-APEX-MYC для метки близости, и экспрессия MIEF1-MP-APEX-MYC была подтверждена вестерн-блоттингом с использованием антител против MYC. (D) "in silico" обратный IP-поиск пептидов MIEF1-MP в данных миторибосомного белка из базы данных Bioplex. Гистограмма показывает количество спектральных отсчетов для пептидов MIEF1-MP в раскрывающихся данных для каждого из белков миторибосомы на оси x из базы данных Bioplex.В дополнение к миторибосомным белкам, обогащенным в эксперименте с близкой меткой (серый цвет), были идентифицированы дополнительные миторибосомные белки, которые были способны обогащать MIEF1-MP (синий).

Этот анализ уменьшил количество вероятных взаимодействующих MIEF1-MP до 100 белков, но мы все еще ограничены отсутствием подходящих антител для подтверждения этих взаимодействий. Вместо этого мы чувствовали, что можем получить необходимую информацию, выполнив поиск общедоступных протеомных наборов данных белок-белкового взаимодействия.Мы решили выполнить поиск в базе данных сети взаимодействия белков Bioplex, 62 , созданной на основе данных масс-спектрометрии с аффинной очисткой для более чем 2500 белков человека в клетках HEK293T. Лентивирусную библиотеку ORF, меченных FLAG-HA, конструировали и инфицировали в клетках HEK293T с последующей иммуноочисткой, расщеплением трипсином и анализом с помощью LC-MS. Были идентифицированы специфические взаимодействия для каждого белка-приманки, которые были собраны в сеть взаимодействия человека Bioplex. Полученная база данных содержит более 23 744 взаимодействий между 7 668 белками.Это беспристрастное картирование взаимодействий также помогает в характеристике неизвестных или плохо изученных белков, предполагая возможную клеточную локализацию, биологический процесс и молекулярную функцию. 62 Наша стратегия состоит в том, чтобы использовать эту базу данных, чтобы определить, были ли какие-либо связывающие MIEF1-MP белки обогащены MIEF1-MP, когда они использовались в качестве белков-приманок, предоставляя нам взаимные данные IP без необходимости каких-либо антител.

Мы загрузили данные протеомики для партнеров связывания MIEF1-MP, которые были приманками в этом эксперименте, из базы данных Bioplex, если таковая имеется.Когда данные Bioplex были собраны и проанализированы, MIEF1-MP не был аннотирован в человеческих базах данных RefSeq или UniProt и, следовательно, не появлялся как член какого-либо белкового комплекса во время первоначального анализа данных Bioplex. Мы провели поиск загруженных данных Bioplex в базе данных UniProt человека с включенным MIEF1-MP. Анализ ACPM / NDUFAB1 обнаружил только один спектральный отсчет от MIEF1-MP, в то время как миторибосомные белки MRPL4, MRPL10, MRPL12, MRPL21 и MRPL39 имели много спектральных отсчетов для MIEF1-MP ().Множественные миторибосомные белки имели высокие спектральные числа () в эксперименте MIEF1-MP-APEX-MYC. В целом, миторибосомные белки были единственным кластером со значительными доказательствами связывания MIEF1-MP, указывающими на то, что в эндогенных условиях (т.е. при отсутствии сверхэкспрессии MIEF1-MP) MIEF1-MP взаимодействует в первую очередь с миторибосомой. Мы подтвердили взаимодействие MRPL4 и MRPS27 с помощью вестерн-блоттинга (и рисунок S3). Наконец, мы проанализировали дополнительные миторибосомные белки в базе данных Bioplex, хотя они не были обогащены в нашем эксперименте MIEF1-MP-APEX-MYC, и обнаружили восемь дополнительных миторибосомных белков, которые обогащали MIEF1-MP (и таблица S1).Кроме того, мы обнаружили, что другие митохондриальные белки (COX4I1,) не обогащают MIEF1-MP, демонстрируя, что MIEF1-MP избирательно связывается с миторибосомами. Наши протеомные данные подтверждают результаты крио-ЭМ-структуры миторибосомы человека, выделенной из клеток HEK293S, которые идентифицировали MIEF1-MP в качестве связывающего партнера миторибосомы 32 (обозначаемый как {"тип": "энтрез-белок", " attrs ": {" text ":" L0R8F8 "," term_id ":" 1160578099 "," term_text ":" L0R8F8 "}} L0R8F8 в этой публикации). Кроме того, предполагается, что MIEF1-MP является фактором сборки миторибосомы из-за его локализации в структуре миторибосомы 32 , и эта предложенная модель согласуется с нашими результатами трансляции, где потеря MIEF1-MP ингибирует трансляцию миторибосомы при сверхэкспрессии MIEF1. -MP ускоряет перевод (см. Ниже).

Таблица 1.

Спектральные подсчеты MIEF1-MP для различных приманок в базе данных Bioplex (цвета соответствуют кластерам в).

9359 MRPL10 9000 3 000935935 MRPS2 000 935

63

63

9000 9000

63

5

63

9352 9352 0 0 ATP5C1 03 00 0 0 0 0 0 0 9165 на скорости митохондриальной трансляции

Миторибосома отвечает за трансляцию митохондриальных РНК, и данные указывают на роль MIEF1-MP в этом процессе (Рисунок S4).Хотя ядерная ДНК кодирует большинство митохондриальных белков, несколько жизненно важных белков кодируются митохондриальной ДНК (мтДНК) и синтезируются независимой митохондриальной системой трансляции 43 . Кодируемая митохондриями мРНК продуцирует 13 субъединиц респираторных комплексов; Субъединицы НАДН-дегидрогеназы комплекса I (MT-ND1, MT-ND2, MT-ND3, MT-ND4L, MT-ND4, MT-ND5, MT-ND6), цитохром b комплекса III (MT-CYB), цитохром с оксидаза субъединицы комплекса IV (MT-CO1, MT-CO2, MT-CO3) и субъединицы АТФ-синтазы комплекса V (MT-ATP6, MT-ATP8).Чтобы определить, модулирует ли MIEF1-MP трансляцию митохондрий, мы начали с измерения стационарных уровней белков, кодируемых мтДНК, с помощью количественной протеомики в сверхэкспрессирующих клетках MIEF1-MP. Мы наблюдали 6-кратное увеличение уровней MIEF1-MP, но отсутствие изменений в концентрациях белков, кодируемых мтДНК (рис. S5), что указывает на то, что MIEF1-MP не влияет на устойчивые уровни белков, кодируемых митохондриями. Затем мы использовали митохондриальный анализ трансляции, который измеряет вновь синтезированные белки, чтобы определить, может ли MIEF1-MP влиять на скорость трансляции митохондриального протеома, которая наблюдалась для других белков в этом комплексе. 63, 64

Вновь синтезированные белки, кодируемые мтДНК, были количественно определены с использованием подхода BioOrthogonal Non-Canonical Amino Acid Tagging (BONCAT). 46 BONCAT вводит химический элемент во вновь синтезированные белки, который можно использовать для обогащения и обнаружения белка (белков). BONCAT полагается на введение неканонической аминокислоты азидогомоаланина (AHA) вместо метионина во вновь синтезированные белки. Маркировка AHA помещает азидную функциональную группу на новые белки, и эти белки впоследствии обогащаются, обнаруживаются и количественно определяются путем нажатия на флуорофор или биотин. 46 Мы сверхэкспрессировали или подавили MIEF1-MP в клетках HEK293T, а затем инкубировали эти клетки с азидогомоаланином (AHA), чтобы обеспечить синтез белка и включение AHA. Эти эксперименты проводились в присутствии эметина, ингибитора цитозольной трансляции, чтобы мы могли сосредоточиться исключительно на продуктах митохондриальной трансляции. После инкубации клетки лизировали и использовали щелочную химию для добавления алкинсодержащего красителя к вновь синтезированным митохондриальным белкам.

Разделение меченых продуктов митохондриальной трансляции с помощью SDS-PAGE выявило роль MIEF1-MP в митохондриальной трансляции. Сравнение сверхэкспрессии MIEF1-MP с контрольными образцами выявило повышенную плотность полос для большинства белков, особенно MT-ND4, MT-CYB, MT-CO2 / MT-ATP6 и MT-ND3, что указывает на то, что MIEF1-MP способствует митохондриальной трансляции (и S5A), и мы подтвердили сверхэкспрессию MIEF1-MP в этих образцах (рисунок S6). Напротив, нокдаун MIEF1-MP привел к более низкой плотности полос для большинства белков, включая MT-CO1, MT-ND4, MT-CYB, MT-ND2, MT-CO3, MT-CO2 / MT-ATP6, MT-ND6 и MT. -ND3, что указывает на снижение митохондриальной трансляции (и S5B).Количественный анализ плотности полос белка, кодируемого мтДНК, выявил устойчивое увеличение (54%) уровней белка при сверхэкспрессии MIEF1-MP и значительное снижение (32%) в клетках, лишенных MIEF1-MP (). Нокдаун MIEF1-MP также приводит к нокдауну MIEF1, и нам нужно было подтвердить, что эти изменения были вызваны MIEF1-MP. Мы экспрессировали миРНК-резистентный MIEF1-MP в клетках, обработанных миРНК против транскрипта MIEF1-MP, и обнаружили, что экспрессия MIEF1-MP спасала потерю трансляции белка (), поддерживая роль MIEF1-MP, а не MIEF1 в митохондриальной трансляции.Эти числа выгодно отличаются от других компонентов миторибосом, таких как MRPL14 и DAP3, которые модулируют трансляцию зарождающихся митохондрий на ~ 40-50%. 63, 64 MIEF1-MP представляет собой биологически активный компонент пути митохондриальной трансляции за счет взаимодействия с миторибосомой.

MIEF1-MP модулирует скорость митохондриальной трансляции. (A) Используя метод BONCAT, вновь синтезированные белки, кодируемые мтДНК, метят красителем IRDye® 800CW и визуализируют на геле. Сверхэкспрессия MIEF1-MP-FLAG в клетках HEK293T увеличивает количество вновь синтезированных митохондриальных белков по сравнению с контролем (вектор pcDNA). (B) Клетки HEK293T, обработанные миРНК MIEF1, привели к снижению уровней трансляции вновь синтезированных белков по сравнению с контрольными клетками, обработанными миРНК. (C) Количественный анализ показал устойчивое изменение уровней вновь синтезированного кодируемого мтДНК белка при сверхэкспрессии и нокдауне микробелка MIEF1. Сравнение измененного образца MIEF1-MP с контролем использовали для определения статистической значимости. Например, сверхэкспрессия MIEF1-MP приводит к статистически значимому увеличению MT-ND4 по сравнению с контролем pcDNA, а миРНК MIEF1-MP приводит к статистически значимому снижению трансляции MT-ND4 по сравнению с контролем siRNA (*, p-значение <0 .05 с использованием t-критерия).

Спасение эффекта лечения миРНК MIEF1 на скорость митохондриальной трансляции.

Используя метод BONCAT, вновь синтезированные белки, кодируемые мтДНК, метят красителем IRDye® 800CW и визуализируют на геле. A) В образце, обработанном миРНК MIEF1, экспрессия MIEF1-MP-FLAG увеличивает количество вновь синтезированных митохондриальных белков по сравнению с контролем (вектор pcDNA). B) Количественный анализ показал устойчивое изменение уровней вновь синтезированного кодируемого мтДНК белка при нокдауне и повторной экспрессии микробелка MIEF1.Сравнение миРНК MIEF1, обработанной повторно экспрессируемым образцом MIEF1-MP, с контролем использовали для определения статистической значимости (*, p-значение <0,05 с использованием t-критерия).

ЗАКЛЮЧЕНИЕ

Здесь мы охарактеризовали микробелок из 70 аминокислот, кодируемый выше гена MIEF1, MIEF1-MP. Мы продемонстрировали, что MIEF1-MP является митохондриальным микробелком и взаимодействует с миторибосомами. Кроме того, экзогенная экспрессия MIEF1-MP с меткой FLAG на С-конце (MIEF-MP-FLAG) показала такую ​​же внутриклеточную локализацию и ассоциацию с миторибосомой, что позволяет предположить, что тег FLAG не мешает функциям MIEF1-MP.Предыдущий успех в использовании белок-белковых взаимодействий для обнаружения функций микропептидов побудил использовать аналогичный подход в этом исследовании. MIEF1-MP обогащал многие белки, но функциональное наблюдение за взаимодействием MIEF1-MP и ACPM / NDUFAB1 показало, что это взаимодействие не имеет функционального значения. Мы предположили, что избыточная экспрессия MIEF1-MP приводит к появлению нефункциональных взаимодействий, таких как ACPM / NDUFAB1, что требует лучшего подхода для проверки партнеров взаимодействия MIEF1-MP.Мы остановились на двухкомпонентном вычислительном подходе, который искал партнеров по взаимодействию белков MIEF1-MP, о которых уже известно, что они взаимодействуют, уменьшая общее количество белков, и обратный IP «in silico», который использовал данные Bioplex для идентификации белков, которые могут обогащать MIEF1-MP из клеток HEK293T. Этот анализ выявил белки, которые являются частью миторибосомы как наиболее подходящие партнеры взаимодействия MIEF1-MP, что мы подтвердили экспериментально с помощью IP с использованием антител MRPL4 и MRPS27 ().Эти результаты также согласуются с более ранней крио-ЭМ структурой миторибосомы, которая обнаружила дополнительную электронную плотность на миторибосоме, принадлежащей MIEF1-MP. 32 Мы проверили гипотезу о том, что MIEF1-MP может быть функциональным компонентом миторибосомы, и получили данные исследований сверхэкспрессии и нокдауна, которые показывают, что MIEF1-MP может регулировать митохондриальную трансляцию, что подтверждает гипотезу о том, что MIEF1-MP является сборкой миторибосомы. фактор. 32

Синтез митохондриального белка является важным процессом у млекопитающих, ответственным за кодирование ключевых компонентов комплексов окислительного фосфорилирования (OXPHOS).Полные молекулярные детали этого обманчиво простого процесса все еще остаются неясными. Проблемы с синтезом митохондриального белка являются основной причиной дисфункции OXPHOS, приводящей к нарушениям обмена веществ и развития. Сердце и мозг особенно чувствительны к дефектам синтеза белков, кодируемых мтДНК, во время позднего эмбрионального или раннего постнатального развития из-за массивного митохондриального биогенеза на этой стадии. Нарушение митохондриальной трансляции вызывает тяжелую педиатрическую кардиомиопатию и заболевание мозга с аномалиями OXPHOS. 65 Кроме того, MIEF1-MP является частью растущего класса недавно открытых митохондриальных микробелков. Наиболее интересным является миторегулин 66 / MOXI 67 , который, как было показано, регулирует бета-окисление 67 , митохондриальную сборку 66 и другие митохондриальные функции. Сходным образом, MIEF1-MP, как сообщается, контролирует деление митохондрий 30 , и здесь мы связываем его с биосинтезом рибосом. Эти результаты могут быть важны, поскольку они могут выявить новую связь между разнородными клеточными путями.Например, мы полагаем, что деление митохондрий с помощью MIEF1 с более длинной ORF на гене MIEF1 может потребовать MIEF1-MP, способствующего трансляции митохондриальных белков. Идентификация MIEF1-MP выявляет новый ген, участвующий в регуляции митохондриальной трансляции, что подчеркивает необходимость дальнейших исследований и важность характеристики микробелков.

Название протеина MIEF1-MP Спектральный счет
MRPL4 9
MRPL10 000 93512
MRPL21 3
MRPL39 4
MRPS2 0 0
MRPS31 0
PTCD3 0
FH 0
GOT2 0
9 9000 9000
9 9000 9000
TIMM44 0
ALDh2B1 0
ETFA 0
ECHS1 0
HADHB 0
HSD17B10 0
0
9AD
GLUD2 0
IVD 0
PDHB 0
PDK1 0
5
5 PDK9000
SUCLA2 0
ALDh2L2 0
IDh4B 0
ETFB 0
0
ATP5F1 0
COX 4I1 0
COX5A 0
NDUFAB1 1
NDUFS1 0
9 0 0 0 0

MIEF1 - Митохондриальный динамический белок MID51 - Homo sapiens (Human)

0 символов

24

0 Завершенное утверждение i 4 0 » 21 243 полноразмерных кДНК человека."
Ота Т., Судзуки Ю., Нисикава Т., Оцуки Т., Сугияма Т., Ирие Р., Вакамацу А., Хаяси К., Сато Х., Нагаи К., Кимура К., Макита Х. , Секин М., Обаяси М., Ниси Т., Шибахара Т., Танака Т., Исии С., Ямамото Дж., Сайто К., Кавай Ю., Исоно Ю., Накамура Ю., Нагахари К., Мураками K., Yasuda T., Iwayanagi T., Wagatsuma M., Shiratori A., Sudo H., Hosoiri T., Kaku Y., Kodaira H., Kondo H., Sugawara M., Takahashi M., Kanda K. , Ёкои Т., Фуруя Т., Киккава Э., Омура Ю., Абэ К., Камихара К., Кацута Н., Сато К., Таникава М., Ямадзаки М., Ниномия К., Исибаши Т., Ямасита Х., Муракава К., Фудзимори К., Танай Х., Кимата М., Ватанабэ М., Хираока С., Чиба Ю., Исида С., Оно Ю., Такигучи С., Ватанабэ С., Йосида М., Хотута Т., Кусано Дж., Канехори К., Такахаши-Фуджи А., Хара Х., Танасе Т.-О., Номура Ю., Тогия С., Комай Ф., Хара Р., Такеучи К., Арита М., Имосе Н., Мусасино К., Юки Х., Осима А., Сасаки Н., Аотсука С., Йошикава Ю., Мацунава Х., Итихара Т., Шиохата Н., Сано С., Мория С., Момияма Х., Сато Н., Таками С., Терашима Й., Судзуки О., Накагава С., Сено А., Мидзогути Х., Гото Й., Симидзу Ф., Вакебе Х., Хишигаки Х., Ватанабэ Т., Сугияма А., Такемото М., Каваками Б., Ямадзаки М., Ватанабе К., Кумагаи А., Итакура С., Фукузуми Ю., Фудзимори Ю., Комияма М., Таширо Х., Танигами А. , Fujiwara T., Ono T., Yamada K., Fujii Y., Ozaki K., Hirao M., Ohmori Y., Kawabata A., Hikiji T., Kobatake N., Inagaki H., Ikema Y., Okamoto С., Окитани Р., Каваками Т., Ногучи С., Ито Т., Сигета К., Сенба Т., Мацумура К., Накадзима Ю., Мидзуно Т., Моринага М., Сасаки М., Тогаши Т., Ояма М., Хата Х., Ватанабэ М., Комацу Т., Мидзусима-Сугано Дж. , Сато Т., Шираи Ю., Такахаши Ю., Накагава К., Окумура К., Нагасе Т., Номура Н., Кикучи Х., Масухо Ю., Ямасита Р., Накай К., Яда Т., Накамура Ю., Охара О., Исогай Т., Сугано С.
Nat. Genet. 36: 40-45 (2004) [PubMed] [Europe PMC] [Реферат]

Цитируется для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ МРНК] (ISOFORM 2).

  • "Ресурс клонов полной ORF немецкого консорциума кДНК."
    Bechtel S., Rosenfelder H., Duda A., Schmidt CP, Ernst U., Wellenreuther R., Mehrle A., Schuster C., Bahr A., ​​Bloecker H., Heubner D., Hoerlein A., Мишель Г., Ведлер Х., Керер К., Оттенвалдер Б., Поустка А., Виманн С., Шупп И.
    BMC Genomics 8: 399-399 (2007) [PubMed] [Europe PMC] [Abstract]

    Цитируется для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [LARGE SCALE MRNA] (ISOFORM 2).

  • Добавить BLAST Отсутствует в форме

    В этом подразделе раздела "Последовательность" описывается последовательность встречающейся в природе альтернативной изоформы (ов) белка.Изменения в аминокислотной последовательности могут быть связаны с альтернативным сплайсингом, использованием альтернативного промотора, альтернативной инициацией или рибосомным сдвигом рамки.

    Подробнее ...

    Альтернативная последовательность i VSP_056383
    108 - 148 DTFCP… RNRAA → GETSYLLPEPGSHPCWRAGS GQASCCGHMCRAPELPAGQV A в изоформе 2.

    Ручное установление последовательности i на основе 4

    41 Альтернативная последовательность i VSP_056384 149 - 463 .

    Ручное утверждение, основанное на мнении в i

    • «Полное секвенирование и характеристика 21 243 полноразмерных кДНК человека».
      Ота Т., Судзуки Ю., Нисикава Т., Оцуки Т., Сугияма Т., Ирие Р., Вакамацу А., Хаяси К., Сато Х., Нагаи К., Кимура К., Макита Х., Секин М., Обаяси М., Ниси Т., Шибахара Т., Танака Т., Исии С., Ямамото Дж., Сайто К., Кавай Ю., Исоно Ю., Накамура Ю., Нагахари К., Мураками К. ., Ясуда Т., Иваянаги Т., Вагацума М., Ширатори А., Судо Х., Хосойри Т., Каку Й., Кодайра Х., Кондо Х., Сугавара М., Такахаши М., Канда К., Йокои Т., Фуруя Т., Киккава Э., Омура Ю., Абе К., Камихара К., Кацута Н., Сато К., Таникава М., Ямазаки М., Ниномия К., Исибаши Т., Ямасита Х., Муракава К., Фудзимори К., Танай Х. , Кимата М., Ватанабэ М., Хираока С., Чиба И., Исида С., Оно Ю., Такигучи С., Ватанабэ С., Йосида М., Хотута Т., Кусано Дж., Канехори К., Такахаши -Fujii A., Hara H., Tanase T.-O., Nomura Y., Togiya S., Komai F., Хара Р., Такеучи К., Арита М., Имосе Н., Мусасино К., Юки Х., Осима А., Сасаки Н., Аотсука С., Йошикава Ю., Мацунава Х., Итихара Т., Шиохата Н., Сано С., Мория С., Момияма Х., Сато Н., Таками С., Терашима Ю., Судзуки О., Накагава С., Сено А., Мидзогути Х., Гото Ю., Симидзу Ф. , Вакебе Х., Хисигаки Х., Ватанабе Т., Сугияма А., Такемото М., Каваками Б., Ямадзаки М., Ватанабе К., Кумагаи А., Итакура С., Фукузуми Ю., Фудзимори Ю., Комияма М., Таширо Х., Танигами А., Фудзивара Т., Оно Т., Ямада К., Фудзи Ю., Одзаки К., Хирао М., Омори Ю., Кавабата А., Хикиджи Т., Кобатаке Н., Инагаки Х., Икема Ю., Окамото С., Окитани Р., Каваками Т., Ногучи С., Ито Т., Сигета К., Сенба Т., Мацумура К., Накадзима Ю., Мидзуно Т., Моринага М., Сасаки М., Тогаши Т., Ояма М., Хата Х. , Ватанабэ М., Комацу Т., Мидзусима-Сугано Дж., Сато Т., Шираи Ю., Такахаши Ю., Накагава К., Окумура К., Нагасе Т., Номура Н., Кикучи Х., Масухо Ю. , Ямасита Р., Накай К., Яда Т., Накамура Ю., Охара О., Исогай Т., Sugano S.
      Nat. Genet. 36: 40-45 (2004) [PubMed] [Europe PMC] [Реферат]

      Цитируется для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ МРНК] (ISOFORM 2).

    • «Ресурс полного клона ORF немецкого консорциума кДНК».
      Bechtel S., Rosenfelder H., Duda A., Schmidt CP, Ernst U., Wellenreuther R., Mehrle A., Schuster C., Bahr A., ​​Bloecker H., Heubner D., Hoerlein A., Michel Г., Ведлер Х., Керер К., Оттенвалдер Б., Поустка А., Виманн С., Шупп И.
      BMC Genomics 8: 399-399 (2007) [PubMed] [Europe PMC] [Резюме]

      Цит. для: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [БОЛЬШОЙ МАСШТАБ МРНК] (ISOFORM 2).

    Добавить BLAST
    315

    SAIS Washington DC Academic Calendar * * может быть изменен по мере необходимости. Ключевые даты

    1 понедельник, 1 июня - четверг, 23 июля 2015 г., пятница, 3 июля 2015 г., вторник, 14 июля - пятница, 21 августа 2015 г., понедельник, 20 июля - понедельник, 7 сентября 2015 г., понедельник, 27 июля - вторник, 25 августа , 2015 Пятница, 21 августа 2015 г. Понедельник, 31 августа 2015 г. Понедельник, 7 сентября 2015 г. Четверг, 10 сентября - суббота, 12 сентября 2015 г. Пятница, 25 сентября 2015 г. Воскресенье, 22 ноября - воскресенье, 29 ноября 2015 г. Пятница, 4 декабря 2015 г. понедельник, 7 декабря 2015 г. среда, 30 декабря 2015 г. понедельник, 11 января - пятница, 22 января 2016 г., понедельник, 25 января 2016 г., четверг, 18 февраля - суббота, 20 февраля 2016 г., пятница, 4 марта 2016 г. Воскресенье, 13 марта - воскресенье, 20 марта 2016 г. Суббота, 30 апреля 2016 г. Среда, 18 мая 2016 г. Академический календарь SAIS в Вашингтоне, округ Колумбия * * может быть изменен по мере необходимости Ключевые даты Соблюдается День независимости SAIS закрыт Летний семестр MIEF Осенние классы 2015 г. Начало Дня труда. SAIS закрыт. Начало обучения GPP и резиденция I. Начало модуля 1 GPP. Осенние каникулы / Неделя благодарения. Начало модуля 2 GPP. Осень 2015 г. cl. окончание оценки Дата конференции для получения осенней степени Межсессия MIEF Начало занятий весной 2016 г. Начало GPP Residency II Начало GPP-модуля Весенние каникулы Весенние классы 2016 завершаются Церемония выпуска JHU в Балтиморе и дата вручения диплома для весеннего получения степени Четверг, 19 мая 2016 г. Церемония выпуска SAIS Понедельник, 16 мая - понедельник, 13 июня 2016 г. Летний семестр MIEF для студентов в когорте Пятница, 20 мая 2016 г. Понедельник, 30 мая - четверг, 21 июля 2016 г. Понедельник, 4 июля 2016 г. Понедельник, 11 июля - четверг, 18 августа 2016 г. Понедельник, 18 июля - понедельник, 5 сентября 2016 г., понедельник, 25 июля - вторник, 23 августа 2016 г., четверг, 25 августа - суббота, 27 августа 2016 г., пятница, 26 августа, 2016 г. - начало модуля 4 GPP День независимости. SAIS закрыт. Летний фестиваль MIEF. срок для когорты GPP Residency III

    2 Лето 2015 г. Понедельник, 18 мая Летний семестр MIEF начинается для студентов в когорте Понедельник, 1 июня - четверг, 23 июля Суббота, 6 июня - воскресенье, 7 июня Понедельник, 15 июня Летний семестр MIEF заканчивается для студентов в когорте Пятница, 3 июля Соблюдается День независимости. SAIS закрыт в понедельник, 6 июля. Регистрация на курсы открывается онлайн на осень 2015 года. Четверг, 9 июля. Обучение на летнее и осеннее время для студентов MIEF. Понедельник, 13 июля. Ориентация на MIEF. Вторник, 14 июля - пятница, 21 августа. MIEF. Летний семестр для когорты. Понедельник, 20 июля - понедельник, 7 сентября понедельник, 27 июля - вторник, 25 августа вторник, 25 августа - четверг, 27 августа MIEF Летние выпускные экзамены пятница, 21 августа

    3 Осень 2015 г. Понедельник, 17 августа, вторник, 25 августа, вторник, 25 августа - четверг, 27 августа, четверг, 27 августа - пятница, 28 августа, пятница, 28 августа, воскресенье, 30 августа, понедельник, 31 августа, понедельник, 31 августа - пятница, сентябрь 11 вторник, 1 сентября - пятница, 4 сентября пятница, 4 сентября понедельник, 7 сентября вторник, 8 сентября вторник, 8 сентября - среда, 9 сентября вторник, 8 сентября - понедельник, 21 сентября четверг, 10 сентября - суббота, 12 сентября пятница , 11 сентября понедельник, 14 сентября - пятница, 25 сентября пятница, 25 сентября понедельник, 28 сентября - пятница, 16 октября понедельник, 12 октября вторник, 13 октября - понедельник, 19 октября вторник, 20 октября Заявление на неполный рабочий день / без получения степени / крайний срок регистрации на осень 2015 г. Оплата за обучение и сборы осенью 2015 г. должна быть произведена в 17:00 для магистрантов, студентов, не имеющих степени, сертификатов и докторантов. все безъязыковые курсы ВСЕ СТУДЕНТЫ ДОЛЖНЫ БЫТЬ ЗАРЕГИСТРИРОВАНЫ ДЛЯ УЧАСТИЯ В ТОРГ.ПЕРВЫЙ ТОРГ ПРОХОДИТ НА ВЫХОДНЫХ ПЕРЕД НАЧАЛОМ УРОКОВ. Плата за обучение по модулю 1 GPP должна быть произведена осенью 2015 года. Начало занятий по онлайн-добавлению / добавлению для неязыковых курсов. Удаление / добавление заканчивается в полдень в пятницу, 11 сентября 2015 г. Языковые курсы / экзамены на знание европейских и евразийских исследований Комплексы I, II и III 17:00 КРАЙНИЙ СРОК ДЛЯ РЕГИСТРАЦИИ НА ВТОРОЙ РАУНД ТОРГОВ НА ОСЕННИЙ СРОК День труда SAIS закрыт Язык начало занятий Отказ от языка онлайн / Добавление GPP Ориентация и проживание I Последний день, чтобы изменить курс первого полугодия с Exceptional Drop / Добавить лично в офисе регистратора для неязыковых курсов с согласия преподавателей Начало модуля GPP 1 Последний день для изменения полного семестрового курса с периода отмены курса в расшифровке стенограммы студента появится буква W, если неязыковой или языковой курс прекращается в течение этого периода. Последний день занятий для первых 7-недельных курсов. Заключительные экзамены для первых 7-недельных курсов. курсы Начало вторых 7-недельных уроков

    4 понедельник, 26 октября пятница, 30 октября пятница, 30 октября суббота, 14 ноября воскресенье, 22 ноября воскресенье, 22 ноября - воскресенье, 29 ноября понедельник, 30 ноября - пятница, 4 декабря пятница, 4 декабря понедельник, 7 декабря вторник, 8 декабря Среда, 9 декабря Четверг, 10 декабря Пятница, 11 декабря Суббота, 12 декабря Понедельник, 14 декабря - пятница, 18 декабря Понедельник, 28 декабря Среда, 30 декабря Крайний срок для подачи неполных оценок за весну 2015 г. без ограничения оценок. 7-недельный курс, начавшийся с 19 октября. Крайний срок подачи заявки на отпуск на весну 2016 г. Последний день для изменения курса второй половины семестра с платы за обучение по модулю 2 GPP, который должен быть сдан на осенние каникулы / Неделя благодарения. Экзамены на знание языка. Модуль 2 GPP начинается в последний день. классов осеннего семестра Неполные оценки весеннего семестра становятся неудачами Последний день для перехода с аудита на зачетные экзамены II и III европейских и евразийских исследований Заключительные экзамены по всей микроэкономике (a.м.) и курсы международной торговли (после обеда). Европейские и евразийские исследования. Комп. I. Выпускные экзамены по всем курсам макроэкономики (до полудня) и теории денег (после обеда). Выпускные экзамены; сверьтесь с графиком выпускных экзаменов Заключительные оценки осеннего семестра должны быть назначены Дата конференции для получения осенней степени

    5 понедельник, 7 декабря 2015 г. пятница, 15 января - воскресенье, 17 января понедельник, 11 января понедельник, 18 января пятница, 22 января понедельник, 25 января пятница, 29 января понедельник, 25 января - пятница, 5 февраля вторник, 26 января - пятница, 29 января пятница, 29 января вторник, 2 февраля вторник, 2 февраля - пятница, 12 февраля пятница, 5 февраля понедельник, 8 февраля - пятница, 19 февраля понедельник, 15 февраля четверг, 18 февраля - суббота, 20 февраля пятница, 19 февраля Суббота, 20 февраля Воскресенье, 21 февраля Понедельник, 22 февраля - пятница, 11 марта Весна 2016 Онлайн-регистрация на весну 2016 года открыта для всех студентов DC первого года обучения.Это последняя возможность для студентов-первокурсников сдать экзамены на отказ. В межсессионный период MIEF начинается обучение на MIEF и плата за обучение весной и летом. Плата за обучение весной 2016 года и сборы должны быть внесены в 17:00 для магистрантов, MIPP, студентов без ученой степени, сертификатов и докторантов. Межсессия MIEF завершается Ориентация для новых MA, MIPP и Аспиранты 18:00 крайний срок для регистрации на все неязыковые курсы. ВСЕ СТУДЕНТЫ ДОЛЖНЫ БЫТЬ ЗАРЕГИСТРИРОВАНЫ ДЛЯ УЧАСТИЯ В ТОРГАХ. ПЕРВЫЙ ТОРГ ПРОХОДИТ НА ВЫХОДНЫХ ПЕРЕД НАЧАЛОМ УРОКОВ.Ориентация MIPP для занятий с весны 2015 г. Начало занятий в весеннем семестре 18:00 КРАЙНИЙ СРОК ДЛЯ РЕГИСТРАЦИИ НА ВТОРОЙ ТОРГ НА ВЕСЕННИЙ СРОК Онлайн-бросок / добавление для неязыковых курсов; онлайн-доступ / добавление закроется в 17:00 в пятницу, 6 февраля. Языковые курсы / экзамены на знание европейских и евразийских исследований. Комплексы I, II и III. Начало языковых классов. Исключительное исключение / добавление лично в Офис Регистратора для неязыковых курсов с согласия преподавателей Дневные занятия президентов будут проводиться. W появится в стенограмме студента, если в течение этого периода будет исключен неязыковой или языковой курс

    6 Пятница, 4 марта Первые 7-недельные занятия заканчиваются пятница, 4 марта. Модуль 3 GPP начинается с понедельника, 7 марта, по пятницу, 11 марта. Заключительные экзамены для первых 7-недельных занятий. Воскресенье, 13 марта - воскресенье, 20 марта. Весенние каникулы, понедельник. 21 марта. Начало семинедельных занятий. Пятница, 25 марта. Крайний срок для подачи неполных оценок за осень 2015 г. без ограничения оценок. Суббота, 26 марта. Пятница, 1 апреля. Крайний срок для отказа от семинедельного курса, который начинался 21 марта. -половину семестр с понедельника, 25 апреля, по пятницу, 29 апреля. Экзамены на знание языка пятница, 29 апреля. Неполные оценки за осенний семестр становятся неудачными. Последний день для перехода с аудита на зачетный. Суббота, 30 апреля. Последний день занятий весеннего семестра, понедельник. , 2 мая, вторник, 3 мая, I и III сборники европейских и евразийских исследований Среда, 4 мая Заключительные экзамены по всей микроэкономике (a.м.) и курсы международной торговли (вечернее время) Четверг, 5 мая, Европейские и евразийские исследования, Comp II Пятница, 6 мая Заключительные экзамены по всем курсам макроэкономики (утро) и денежной теории (вечер) Воскресенье, 8 мая Плата за обучение по модулю 4 GPP должна быть в понедельник, 9 мая - пятница, 13 мая Выпускные экзамены; см. расписание выпускных экзаменов понедельник, 16 мая. Выпускные оценки весеннего семестра должны быть сданы в среду, 18 мая. Церемония выпуска JHU в Балтиморе и дата вручения весенней степени. Четверг, 19 мая. Церемония выпуска SAIS. Пятница, 20 мая. Модуль 4 GPP начинается во вторник, 31 мая. Крайний срок. для запроса отпуска на осень 2016 г.

    7 Лето 2016 г. Понедельник, 16 мая Летний семестр MIEF начинается для студентов когорты Понедельник, 30 мая - четверг, 21 июля Суббота, 4 июня - воскресенье, 5 июня Понедельник, 13 июня Летний семестр MIEF заканчивается для студентов в когорте Понедельник, 20 июня - Четверг, 28 июля. Летние программы в Нанкине, Китай. Понедельник, 4 июля. День независимости SAIS закрыт. Понедельник, 11 июля. Регистрация на курсы открывается онлайн на осень 2016 года. Четверг, 7 июля. Обучение на лето и осень для студентов MIEF. Пятница, 8 июля. Ориентация на MIEF. Понедельник, 11 июля - четверг, 18 августа. Летний семестр MIEF для когорты Понедельник, 18 июля - понедельник, 5 сентября Понедельник, 25 июля - вторник, 23 августа Понедельник, 22 августа - среда, 24 августа. Летние выпускные экзамены MIEF Четверг, 25 августа - Суббота, 27 августа GPP Residency III Пятница, 26 августа Воскресенье, 28 августа Плата за обучение по модулю GPP 5 составляет

    календарь регистратора jhu

    SIS также позволяет просматривать информацию об учетной записи учащегося, включая финансовую помощь, расписание занятий и свои оценки.Чтобы зарегистрироваться на курсы в SIS, сначала проверьте академический календарь, чтобы убедиться, что регистрация открыта на следующий академический семестр. Первоначальный срок оплаты за обучение летом 2021 года (после этого ежемесячная оплата), последний день подачи заявления на выпускной экзамен на летний семестр 2021 года, праздник четвертого июля; уроки не проводятся, летние курсы 2021 года (начинающиеся с 11 июля по 23 августа) будут отменены из-за недостаточной регистрации. Дата, когда любая (неполная) оценка, записанная в SIS за семестр весны 2021 года, автоматически заменяется оценкой F на академическая справка студента, дата, когда любая (неполная) оценка, записанная в SIS на летний семестр 2021 года, автоматически заменяется оценкой F в академической справке студента, дата подачи приоритетной финансовой помощи на осенний семестр 2021 года, осенние курсы 2021 года будут отменены из-за недостаточного количества учащихся, Первоначальный срок оплаты за обучение осенью 2021 года (после этого ежемесячная оплата), Последний день подачи заявления на выпускной семестр на осенний семестр 2021 года, Дата, когда любая (неполная) оценка I (неполная), зарегистрированная в SIS за осенний семестр 2021 года, автоматически заменяется Оценка F в академической справке студента, дата подачи приоритетной финансовой помощи на семестр весны 2022 года, курсы весны 2022 года будут отменены из-за недостаточного набора Ent, Первоначальный срок оплаты обучения весной 2022 года (после этого ежемесячная оплата), Последний день подачи заявки на выпускной семестр весны 2022 года, Крайний срок подачи заявки на получение стипендии SOE для вновь зачисленных и текущих студентов EdD, Дата приоритетной подачи финансовой помощи на летний семестр 2022 года, Дата при этом любая (неполная) оценка, записанная в SIS на весенний семестр 2022 года, автоматически заменяется оценкой F в академической справке студента.Академический календарь. Используйте форму ниже для поиска расписания курсов. Плавающие ресурсы для студентов в течение полного рабочего дня. Телефон: (410) 516-4050. Летний семестр ММЭФ для студентов когорты 2020-2021 гг. Календарь регистрации Офис Регистратора Университета ведет дела по телефону и виртуально. Факультет; Посещение факультета; Сотрудники; Аспиранты; Кандидаты на рынке труда; Выпускник. Обратите внимание, что будут добавлены дополнительные даты для удаления / добавления и снятия, и при необходимости будут внесены корректировки.Думаете о поступлении в Университет Джона Хопкинса? Мы доступны с понедельника по пятницу с 8:30 до 16:30. Обратите внимание, что будут добавлены дополнительные даты для удаления / добавления и снятия, и при необходимости будут внесены корректировки. Ниже представлена ​​информация о записи на занятия в Bloomberg School. Университет Джона Хопкинса предлагает степень бакалавра в области искусства, естественных, социальных, инженерных и гуманитарных наук. . Проект 10-летнего модельного календаря в настоящее время доступен на сайте регистратора.Основные характеристики академического календаря Бретани Грин Календарь был создан при консультациях с… Праздники для членов переговорной единицы указаны в соглашении между JHU и Local 572. Даты начала семестров и восьминедельные учебные периоды согласованы. Продвинутые академические программы Джонса Хопкинса. Даты обучения для всех школ указаны на следующих страницах. Все файлы в формате PDF. asta 18.06.2020. Результаты поиска для: Академический календарь Jhu Registrar. Выберите год 2020-2021 2019-2020 2018-2019 2017-2018 Меню Закрыть.Необязательные летние семестр по-прежнему варьируются с меньшим количеством учебных моделей. Чтобы ваше мероприятие было добавлено в календарь, отправьте подробную информацию по адресу [email protected] Академический календарь Jhu на 2021-22 гг. 410-516-4925, Этот веб-сайт использует файлы cookie и аналогичные технологии, чтобы лучше понимать опыт посетителей. Аспирантура. Загрузка системных объявлений. Офис по продвинутым академическим программам службы регистрации расположен в офисном здании Джонса Хопкинса Бернштейна, 1717 Массачусетс-авеню., N.W., Suite 101, Вашингтон, округ Колумбия, 20036-2001 гг. 2800 N. Charles Street Продолжая просмотр этого веб-сайта, вы соглашаетесь с использованием этих технологий Университетом Джона Хопкинса в соответствии с указаниями Центра исследований и реформ в области образования, Центра социальной организации школ, даты подачи приоритетной финансовой помощи для Летний семестр 2021 года, летние курсы 2021 года (с 1 июня по 10 июля) будут отменены из-за недостаточной регистрации. Школа медсестер Университета Джона Хопкинса 525 N.Вулф-стрит, Студенческий дом 210/211 Балтимор, Мэриленд 21205, стр. 410-614-3096 | F. 410-367-3285 [email protected] Студенты будут оплачиваться отдельно на летних программах. Календарь будет составлен и опубликован на десять лет для улучшения академического и административного планирования. Бакалавриат в Hopkins - это четырехлетняя степень, состоящая из широких, междисциплинарных требований к распределению и концентрированной курсовой работы в основной академической области, известной как майор. Летом 2021 года регистрация возобновится в 7 часов утра.м. Понедельник, 31 мая - понедельник, 28 июня 2021 г. Наши люди. - Звоните 410-662-5850. Календарь событий. Церемония выпуска JHU в Балтиморе и дата вручения весенней степени. Контакт. Заявки принимаются круглый год. Дом. Список нынешних и прошлых преподавателей и посетителей JHU Economics; Новостная рассылка; Календарь событий; Архив новостей; Люди. Календарь был составлен по согласованию с деканами школ и регистраторами за последние три года; Календарь будет составлен и опубликован на десять лет для улучшения академического и административного планирования.Мероприятие Весна 2021 ЛЕТО 2021 осень 2021 * Регистрация открывается 29 октября 2020 года 25 марта 2021 года 9 июля 2021 года Первый день занятий Январь ... Все другие мероприятия, проводимые в Школе - от известных докладчиков до семинаров по защите диссертаций - можно найти в мероприятиях календарь. Вторник, 1 июня - четверг, 14 июля 2021 г. ВЕСЕННИЙ ПЕРЕРЫВ 2021 года: для снижения рисков COVID, связанных с поездками, весенние каникулы будут заменены отдельными выходными днями, распределяемыми в течение семестра. Услуги предоставляются по электронной почте: [email protected] и по телефону: (667) 208-6583 или (667) 208-6580.Студенты могут найти дополнительную информацию в Справочнике для студентов бакалавриата и Справочнике для выпускников и профессиональных студентов. ВНИМАНИЕ: расписание на весну 2021 года может быть изменено из-за сбоев, связанных с COVID-19. Хотя даты начала условий могут повлиять на текущие ожидания, общие календари разработаны таким образом, чтобы минимизировать корректировки, которые нам всем придется внести. Балтимор, Мэриленд 21218 - Подтвердите свой выбор учебника «Лето в Хопкинсе» (если таковой имеется) по электронной почте [email protected] Если у вас есть дополнительные вопросы, вы можете связаться с Офисом записи и регистрации или войти на портал по адресу my.jhsph.edu .. Студенты, ищущие ученую степень и получившие свидетельство, получают указания. Посетите Back2BU для получения последних обновлений и информации о реакции BU на COVID-19. asta 05.03.2020. JHU определяет определенные дни в году как общеуниверситетские праздники и публикует двухлетний Календарь праздников. Балтимор, MD 21218 Для некоторых запросов может потребоваться подпись и удостоверение личности с фотографией, предоставленные по электронной почте. Пожалуйста, свяжитесь с офисом регистратора Пибоди по адресу [email protected] или 667-208-6583 / 6580, если потребуется помощь.2021-2022 Академический календарь. Свяжитесь с экспертом Пожалуйста, учитывайте увеличенное время ответа. Университет Джона Хопкинса является утвержденным учреждением для получения льгот для ветеранов, включая следующие программы. Офис Регистратора Медицинского факультета Университета Джона Хопкинса является хранилищем всех академических записей для студентов-медиков и аспирантов медицинского факультета; это также официальный офис для докторантов, домашнего персонала, стажеров и наблюдателей. Телефон: 410-234-9250 Электронная почта: [email protected] Адрес: 100… Проверьте академический календарь, чтобы узнать о крайних сроках регистрации. Начало регистрации: вторник, 1 декабря. Начало сессий: понедельник, 4 января. Окончание сессий: пятница, 15 января. Весна 2021 года. Офис Регистратора. - Отправьте форму заказа учебника по адресу [email protected] за 6–8 недель до начала занятий. Важное сообщение для студентов-очников. . Применять в любое время. Узнайте больше об использовании преимуществ VA… Академический календарь на 2021-2022 годы. Мы приносим свои извинения за доставленные неудобства. Офис Регистратора закроется сегодня, 5 февраля, в 13:00 EST.Там пользователи могут просматривать календарь с точки зрения каждой школы, отмечая уникальные даты перерыва и окончания своей программы. Вторник, 1 июня - воскресенье, 25 июля 2021 г .: Летние онлайн-программы в Вашингтоне, округ Колумбия. Эти общие календари помогают студентам обдумывать и, возможно, принимать предложения по учебным программам в разных подразделениях. Адрес. Просмотр календарей каждой из наших девяти школ на 2014-15 учебный год [tribe_events] Просмотр академического календаря на этот год или справочных календарей за предыдущие годы.Регистратор академического календаря Университета штата Северная Каролина. Поиск класса (вход в систему не требуется) Объявления SIS. Комментарии и вопросы по модельному календарю принимаются в ЗАГС вуза до 17 апреля. Академический календарь на 2021-2022 гг. Перейдите в Академический календарь. Если у вас возникли трудности с регистрацией через SIS, просто заполните и отсканируйте свою бумажную форму (регистрационную форму или форму добавления / отправки) в Офис Регистратора по адресу [email protected], поскольку факсы и почта не могут обрабатываться в это время удаленной работы.Если вы не можете воспользоваться услугами Национального центра обмена информацией для студентов или имеете дело, требующее особой помощи со стороны Регистратора,… 410-516-4925, 2800 N. Charles Street Посетите наш сайт приема для получения дополнительной информации. Даты обучения для всех школ указаны на следующих страницах. Если вы студент, обязательно сверяйтесь с академическим календарем в течение года для получения информации о расписании занятий и праздниках. Навигация по сайту Обратитесь в офис Регистратора.3400 North Charles Street Baltimore, MD 21218. Регистрация. В этом академическом календаре указаны важные даты и крайние сроки, о которых вам нужно знать в текущем и предстоящем семестрах. Офис Регистратора; Академический календарь (очные программы) Академический календарь (заочные / интерактивные инженерные программы) ... Университет Джона Хопкинса, Инженерная школа Уайтинга. ПОСЛЕДНИЕ ИЗМЕНЕНИЯ В КАЛЕНДАРЬ 2020-2021 БЫЛИ ВНЕСЕНЫ 15 ЯНВАРЯ 2021 ГОДА. Расписание курсов; Требования к программе; Для соискателей. 2 февраля 2021 г., 8:21.Кэсси Крик Директор по записи и регистрации 410-614-3096 | [email protected] Законопроект о GI после 9/11 ® (Соответствует требованиям с желтой лентой) Мы участвуем в Программе желтой ленты после 9/11 GI Bill ®. Регистрация на лето 2020 года началась 24 марта 2020 года и продлится до начала летнего семестра, 1 июня 2020 года. Глобальные случаи коронавируса COVID-19 от Центра системных наук и инженерии (CSSE) при Университете Джона Хопкинса (JHU) Добро пожаловать в Офис Регистратора! JHU оставляет за собой право вносить изменения до или в течение семестра, включая изменение формы обучения, изменение академического календаря, добавление или исключение курсов или программ, а также изменение или приостановление предоставления студентам жилья, услуг и доступа, предоставляемых JHU. к объектам, мероприятиям и событиям или другим ресурсам.Эти информационные услуги предоставляются Johns Hopkins, чтобы помочь в выполнении его бизнеса и миссии. Как зарегистрироваться на курсы. 2021 2022 Академический календарь> Академический календарь Управления регистратора университета | Инжиниринг для профессионалов | Джонс Хопкинс Подробнее. Кампус и виртуальные летние программы в Вашингтоне, округ Колумбия. Позвоните по телефону 530-752-3639, пн-пт, 10:00 - 16:00 (тихоокеанское время) Заказать официальные электронные стенограммы UC Davis Нужна помощь? Основные возможности академического календаря. Общую форму петиции можно загрузить и отправить по почте вместе с подтверждающей документацией в офис регистратора, бизнес-школу Джонса Хопкинса Кэри, 100 International Drive, Балтимор, MD 21202, по факсу на 410-800-4096 или по электронной почте[email protected]jhu.edu.

    Astuce Accident De Travail, Дикие тигры, которых я знаю, наблюдают, Qantas Check-in Online, Journée Internationale Des Forêts 2020, Меган отсутствует в ролях, Дикие тигры, которых я знаю, наблюдают,

    SAIS Washington DC Academic Calendar * * может быть изменен по мере необходимости. Ключевые даты

    1 пятница, 20 мая 2016 г. понедельник, 6 июня - четверг, 28 июля 2016 г., понедельник, 4 июля 2016 г., вторник, 19 июля - пятница, 26 августа 2016 г., понедельник, 18 июля - понедельник, 5 сентября 2016 г., понедельник, август 1 - вторник, 30 августа 2016 г., четверг - суббота, 25–27 августа 2016 г., пятница, 26 августа, 2016 г., понедельник, 5 сентября, 2016 г., вторник, 6 сентября 2016 г., четверг - суббота, 8–10 сентября 2016 г., пятница, 9 сентября , 2016 Пятница, 23 сентября 2016 г. Понедельник - пятница, 14–18 ноября 2016 г. Воскресенье, 20 ноября - воскресенье, 27 ноября 2016 г. Пятница, 2 декабря 2016 г. Понедельник, 12 декабря 2016 г. Пятница, 30 декабря 2016 г. Понедельник, январь 16– пятница, 27 января 2017 г. понедельник, 30 января 2017 г. четверг – суббота, 16–18 февраля 2017 г. пятница, 10 марта 2017 г. воскресенье, 19 марта - воскресенье, 26 марта 2017 г. суббота, 6 мая 2017 г. среда, май 24 декабря 2017 г. Академический календарь SAIS в Вашингтоне, округ Колумбия * * может быть изменен по мере необходимости Ключевые даты Начало модуля GPP 4 MIEF Летний семестр для когорты День труда SAIS закрыт Начало занятий Осенью 2016 г. Начало GPP Ориентация и Резиденция I Начало модуля 5 GPP Начало модуля 1 GPP Начало резидентства IV (международное) Осенние каникулы / Неделя благодарения Начало модуля 2 GPP Осень 2015 г. Окончание занятий Дата конференции для получения осенней степени Межсессия MIEF Начало занятий весной 2016 г. Начало занятий GPP Резидентство II Начало модуля 3 GPP Весенние каникулы Весной 2016 года уроки заканчиваются на выпускной церемонии JHU в Балтиморе и назначается дата получения весенней степени Четверг, 25 мая 2017 г. Церемония выпуска SAIS Пятница, 19 мая 2017 г. студенты в когорте Понедельник, 5 июня - четверг, 27 июля 2017 г. Вторник, 4 июля 2017 г. Понедельник, 17 июля - четверг, 24 августа 2016 г. Понедельник, 17 июля - понедельник, 4 сентября 2017 г. Понедельник, 31 июля - вторник, август 29 августа 2017 г., четверг - суббота, 24-26 августа 2017 г., пятница, 25 августа 2017 г. MIEF Летний семестр для когорты

    2 Лето 2016 г. Понедельник, 16 мая Летний семестр MIEF начинается для студентов когорты Понедельник, 6 июня - четверг, 28 июля Суббота, 4 июня - воскресенье, 5 июня Понедельник, 13 июня Летний семестр MIEF заканчивается для студентов в когорте Понедельник, 4 июля Понедельник, 11 июля. Открывается онлайн-регистрация на курсы осенью 2016 года. Четверг, 7 июля. Обучение на летнее и осеннее время для студентов MIEF. Пятница, 8 июля. Ориентация на MIEF. Понедельник, 11 июля - четверг, 18 августа. , 5 сентября понедельник, 1 августа - вторник, 30 августа понедельник, 22 августа - среда, 24 августа Летние выпускные экзамены MIEF Четверг, 25 августа - суббота, 27 августа пятница, 26 августа воскресенье, 28 августа Срок обучения по модулю 5 GPP

    3 Осень 2016 г. Понедельник, 15 августа, вторник, 30 августа, вторник, 30 августа - четверг, 1 сентября, четверг и пятница, 1-2 сентября, пятница, 2 сентября, воскресенье, 4 сентября, понедельник, 5 сентября, вторник, 6 сентября, вторник, 6 сентября - Пятница, 16 сентября, вторник-пятница, 6-9 сентября, четверг-суббота, 8-10 сентября, пятница, 9 сентября, вторник, 13 сентября, вторник-среда, сентябрь, вторник, 13 сентября - понедельник, 26 сентября, пятница, 16 сентября, понедельник, 19 сентября. - пятница, 30 сентября, пятница, 23 сентября, пятница, 30 сентября, понедельник, 3 октября - пятница, 21 октября, понедельник, 17 октября, вторник, 18 октября - понедельник, 24 октября. Осенью 2016 года обучение и сборы должны быть произведены в 17:00 для студентов магистратуры, магистратуры, магистратуры, аттестата и докторантуры. Ориентация на студентов магистратуры, магистратуры и докторантуры. Крайний срок регистрации на все неязыковые курсы - 18:00. ЗАРЕГИСТРИРОВАНА ДЛЯ УЧАСТИЯ В ТОРГАХ.ПЕРВЫЙ ТОРГ ПРОХОДИТ НА ВЫХОДНЫХ ПЕРЕД НАЧАЛОМ УРОКОВ. Плата за обучение по модулю 1 GPP должна быть оплачена. День труда. SAIS закрывается. Осенью 2016 г. начинается курс онлайн-добавления / добавления для неязыковых курсов. Удаление / добавление заканчивается в полдень в пятницу, 16 сентября 2016 г. Экзамены на размещение / квалификацию GPP Ориентация и резидентство I Европейские и евразийские исследования Комплексы I, II и III 17:00 КРАЙНИЙ СРОК ДЛЯ РЕГИСТРАЦИИ НА ВТОРОЙ ТОРГ НА ОСНОВНОЙ СРОК GPP Начало модуля 5. Начало языковых курсов. Отмена / добавление языка онлайн. Последний день, чтобы изменить курс первого полугодия с исключительного отказа / Добавить лично в офисе регистратора для неязыковых курсов с согласия преподавателей. Начало модуля 1. изменить полносеместровый курс с периода отмены курса. Если в течение этого периода не языковой или языковой курс прекращается, в стенограмме студента будет отображаться буква W. Последний день занятий для первых 7-недельных курсов. Заключительные экзамены для первых 7-недельных курсов.

    4 вторник, 25 октября понедельник, 31 октября пятница, 4 ноября суббота, 12 ноября понедельник-пятница, воскресенье ноября, 20 ноября воскресенье, 20 ноября-воскресенье, 27 ноября понедельник-пятница, 5-9 декабря пятница, 2 декабря понедельник, 12 декабря Вторник, 13 декабря Среда, 14 декабря Четверг, 15 декабря Пятница, 16 декабря Суббота, 17 декабря Понедельник-пятница, Декабрь Среда, 28 декабря Пятница, 30 декабря Начало вторых 7-недельных уроков. ограничение класса Крайний срок для отказа от 7-недельного курса, который начинался с 24 октября Крайний срок для запроса отпуска на весну 2016 г. Последний день для изменения курса второй половины семестра с GPP Residency IV (International) GPP Module 2, срок обучения на осенних каникулах / Неделя благодарения Экзамены на знание языка Начало модуля 2 GPP Последний день занятий осеннего семестра Неполные оценки весеннего семестра становятся неудачными Последний день для перехода с аудита на зачетные. III Выпускные экзамены по всей микроэкономике (a.м.) и курсы международной торговли (после обеда). Европейские и евразийские исследования. Комп. I. Выпускные экзамены по всем курсам макроэкономики (до полудня) и теории денег (после обеда). Выпускные экзамены; сверьтесь с графиком выпускных экзаменов Заключительные оценки осеннего семестра должны быть назначены Дата конференции для получения осенней степени

    5 понедельник, 12 декабря 2016 г. пятница - воскресенье, январь понедельник, 16 января пятница, 27 января понедельник, 30 января понедельник, 30 января - пятница, 10 февраля вторник, 31 января - пятница, 3 февраля пятница, 3 февраля вторник, февраль 7 вторник, 7 февраля - пятница, 17 февраля пятница, 10 февраля понедельник, 13 февраля - пятница, 24 февраля, понедельник, 20 февраля, четверг - суббота, февраль, пятница, 24 февраля, суббота, 25 февраля, воскресенье, 26 февраля, понедельник, 27 февраля - пятница. , 17 марта Весна 2017 года. Онлайн-регистрация на весеннюю сессию 2017 года открыта для всех студентов первого курса округа Колумбия.Это последняя возможность для студентов-первокурсников сдать экзамены на отказ. В период между сессиями MIEF начинается обучение на MIEF и плата за обучение весной и летом. Плата за обучение весной и летом 2017 года. Плата за обучение и сборы должны быть внесены в 17:00 для студентов MA, MIPP, студентов без степени, сертификатов и докторантов. Межсессия MIEF завершается Ориентация для новых MA, MIPP и Аспиранты 18:00 крайний срок для регистрации на все неязыковые курсы. ВСЕ СТУДЕНТЫ ДОЛЖНЫ БЫТЬ ЗАРЕГИСТРИРОВАНЫ ДЛЯ УЧАСТИЯ В ТОРГАХ. ПЕРВЫЙ ТОРГ ПРОХОДИТ НА ВЫХОДНЫХ ПЕРЕД НАЧАЛОМ УРОКОВ.Уроки весеннего семестра начинаются онлайн Drop / Add для неязыковых курсов; Online Drop / Add закроется в полдень в пятницу, 10 февраля. Языковые курсы / экзамены на знание 18:00 КРАЙНИЙ СРОК ДЛЯ РЕГИСТРАЦИИ НА ВТОРОЙ РАУНД ТОРГОВ НА ВЕСНУЮ СРОКУ Комплексы I, II и III по европейским и евразийским исследованиям начинаются языковые курсы онлайн. / Добавить Последний день, чтобы изменить курс первой половины семестра с Исключительного исключения / Добавить лично в Офис Регистратора для неязыковых курсов с согласия преподавателей зачетный курс для аудита Срок оплаты за обучение по модулю 3 GPP Период отмены курса В стенограмме студента будет отображаться буква W, если неязыковой или языковой курс будет исключен в течение этого периода

    6, пятница, 10 марта. Завершение первых 7-недельных занятий. Модуль 3 GPP начинается с понедельника по пятницу, март. Заключительные экзамены для первых 7-недельных занятий. Воскресенье, 19 марта - воскресенье, 26 марта. Весенние каникулы, понедельник, 27 марта. 7-недельные занятия начинаются в пятницу. , 31 марта Крайний срок для подачи неполных оценок на осень 2016 г. без ограничения оценок Суббота, 1 апреля, пятница, 7 апреля Крайний срок для отказа от 7-недельного курса, который начинался с 27 марта. Последний день для изменения курса второй половины семестра с понедельника по Пятница, 1-5 мая Экзамены на знание языка Пятница, 5 мая Неполные оценки за осенний семестр становятся неудачными. Последний день для изменения курса с аудита на зачетный. Суббота, 6 мая. Последний день занятий весеннего семестра. Понедельник, 8 мая. Вторник, 9 мая. I и III сборники евразийских исследований Среда, 10 мая Заключительные экзамены по всей микроэкономике (a.м.) и курсы международной торговли (вечернее время) Четверг, 11 мая, Европейские и евразийские исследования, Comp II Пятница, 12 мая Заключительные экзамены по всем курсам макроэкономики (утро) и монетарной теории (вечер) Воскресенье, 14 мая Плата за обучение в модуле 4 GPP должна быть начата в понедельник - Пятница, май Выпускные экзамены; см. расписание выпускных экзаменов Пятница, 19 мая Начало модуля 4 GPP в понедельник, 22 мая. Окончательные оценки за весенний семестр в среду, 24 мая. Церемония выпуска JHU в Балтиморе и дата получения весенней степени. Четверг, 25 мая. Церемония выпуска SAIS среда, 31 мая. Крайний срок. для запроса отпуска на осень 2017 г.

    7 Лето 2017 г. Понедельник, 29 мая Летний семестр MIEF начинается для студентов в когорте Понедельник, 5 июня - четверг, 27 июля Суббота - воскресенье, июня Понедельник, 26 июня Летний семестр MIEF заканчивается для студентов в когорте Вторник, 4 июля Понедельник, 10 июля Регистрация на курсы открывается онлайн на осень 2017 г., четверг, 13 июля. Обучение на летнее и осеннее время для студентов MIEF Понедельник, 17 июля. Ориентация на MIEF, вторник, 18 июля - пятница, 25 августа. Летний семестр MIEF для когорты Понедельник, 17 июля - понедельник, 4 сентября, понедельник. , 31 июля - вторник, 22 августа, вторник - четверг, август.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *