Юля мишина: Юлия Мишина — Авторы статей и новостей МК

Содержание

Юля Мишина, Москва, Россия — полная информация о человеке из профиля (id12310313) в социальных сетях (ВКонтакте)

Юля Мишина

Информации о личной жизни Юли не найдено

Я не знаю никого стервознее случайности.

Фотографии

Просмотреть нельзя из-за настроек приватности профиля

Основная информация о Мишиной Юле

  • Имя

    Юля

  • Фамилия

    Мишина

  • Девичья фамилия

    Не указана

  • Пол

    Женщина

  • День рождения

    21

  • Месяц рождения

    март

  • Год рождения

    Скрыт

  • Дата рождения

    21.3

  • Полных лет

    Скрыто

  • Кто по гороскопу

    Овен

  • Страна

    Россия

  • Родной город

    Не указан

  • Город проживания

    Москва

  • Электронная почта (email)

    Скрыто

  • Номер телефона

    Известен, но скрыт

  • Владение языками

    Скрыто или не заполнено

Контакты, ссылки

  • Facebook

    Не указан

  • Twitter

    Не указан

  • Instagram

    Не указан

  • LiveJournal

    Не указан

  • Skype

    Не указан

  • VK ссылка

    id12310313

  • Личный сайт

    Не указан

Основная информация о её VK профиле

  • Галочка верификации

    Отсутствует

  • Дата регистрации профиля ВКонтакте

    26 апреля 2008 года

  • Прошло после регистрации

    13 лет 5 месяцев 21 день

  • Онлайн ли сейчас

    Нет

  • Когда была онлайн

    17 октября 2021 в 04:02:04

  • С какого устройства заходила

    Через приложение для iPhone

  • ID профиля

    12310313

  • Никнейм (псевдоним)

    Короткий адрес страницы (домен, никнейм) не задан

Настройки приватности страницы Юли

Наполнение страницы

Где училась и работала

  • Школа

    Информация не указана или скрыта настройками приватности

  • ВУЗ

    Информация не указана или скрыта настройками приватности

  • Работа

    Информация не указана или скрыта настройками приватности

Хобби, интересы, увлечения

  • Деятельность

    Не указано или скрыто

  • Интересы

    Не указано или скрыто

  • Любимая музыка

    Не указано или скрыто

  • Любимые фильмы

    Не указано или скрыто

  • Любимые книги

    Не указано или скрыто

  • Любимые игры

    Не указано или скрыто

  • Любимые TV-шоу

    Скрыто или не указано

  • Любимые цитаты

    Не указано или скрыто

  • О себе

    Информация скрыта или не указана

Жизненная позиция

  • Главным в жизни считает

    Скрыто или не заполнено

  • Главным в людях считает

    Скрыто или не заполнено

  • Политические предпочтения

    Скрыто или не заполнено

  • Источники вдохновения

    Скрыто или не заполнено

  • Мировоззрение

    Скрыто или не заполнено

  • Как относится к алкоголю

    Скрыто или не заполнено

  • Как относится к курению

    Скрыто или не заполнено

Список друзей

К сожалению, не удаётся получить список друзей Юли.
Если статус профиля VK значится как «закрытый», это вполне нормально.
В противном случае попробуйте обновить данную страницу, иногда это помогает.

Удалить страницу

Если Вы являетесь владельцем этого vk профиля id12310313, можете легко его удалить с сайта profiles-vkontakte.ru, вся информация с этой страницы исчезнет, будто её тут и не было никогда. И гарантированно не появится тут снова.

Для удаления придётся кое-что сделать, чтобы алгоритм мог Вас идентифицировать, как владельца профиля. Ничего сложного и трудоёмкого: просто в качестве своего статуса ВКонтакте (именно на страничке где id 12310313) напишите

pvkontakte123, без всяких пробелов и других символов, после чего нажмите кнопку «УДАЛИТЬ ПРОФИЛЬ».

Так система поймёт, что Вы — это действительно Вы, после чего произойдёт удаление, полностью в автоматическом режиме. Разумеется, после успешного удаления можно удалить статус pvkontakte123, поменять его, делать с ним всё что угодно — идентификация более не требуется.

А теперь ещё раз, коротко:

  1. Устанавливаете статус pvkontakte123
  2. Нажимаете кнопку УДАЛИТЬ ПРОФИЛЬ
  3. Вся публичная информация из vk о вас удаляется с profiles-vkontakte.ru навсегда.

Удалить профиль

Юля Мишина, 30 лет, Винница, Украина

Личная информация

Деятельность

скрыта или не указана

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Интересы

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимая музыка

скрыта или не указана

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимые фильмы

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности:

да


Любимые телешоу

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимые книги

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимые игры

скрыты или не указаны

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Любимые цитаты

скрыты или не указаны

Можно редактировать:

да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


О себе

скрыто или не указано

Можно редактировать: да

Обязательно к заполнению: нет

Можно скрыть настройками приватности: да


Юля Мишина, Россия, Волгоград | Служба поиска людей Poisk Center

Юля Мишина проживает в городе Волгоград, Россия. Родной город — Москва. Семейное положение Юли: замужем. Из открытых источников получены следующие сведения: информация о высшем и среднем образовании, карьере.

Расширенные данные / Биография Юли

Страна: Россия
Город: Волгоград
Место рождения: Москва
Возраст: нет данных
Дата рождения: нет данных
Знак зодиака: нет данных
Семейное положение: состоит в браке

Место жительства

Среднее образование

Школа №83 Россия, Волгоград

Высшее образование

ВолгГАСУ, дата окончания: 2010

Факультет: Факультет транспортных, инженерных систем и техносферной безопасности ИАиС

Кафедра: Экономики и управления дорожным хозяйством

Статус: Выпускница (специалист), Очное отделение

Россия, Волгоград

Работа и карьера

Лайки \ Добавь \ Друзья \ Пиар

консультант

2014 Россия, Волгоград

Социальные сети

Facebook нет данных
Twitter нет данных
Instagram нет данных
ВКонтакте id265001397
Одноклассники нет данных
Мой Мир@Mail.ru нет данных

Источник информации

Информация получена из общедоступного открытого источника.
За достоверность информации сайт ответственность не несет.

Если это ваша анкета, то вы можете ее удалить. Перейти к удалению анкеты

Благотворительный фонд «ОМК-Участие» поздравил детей из онкоцентра на Каширке с Новым годом

Фонд «ОМК-Участие» (создан по инициативе руководителей и сотрудников Объединенной металлургической компании, АО «ОМК», г. Москва) в рамках ежегодной благотворительной акции «С миру по елке» провел для пациентов детского отделения Национального медицинского исследовательского центра онкологии им. Н.Н. Блохина в Москве новогоднее представление.

Маленькие пациенты уже много месяцев находятся на карантине в стенах лечебного заведения, поэтому впервые новогоднее представление было уличным, разворачивалось перед окнами палат на специально установленной сцене. Настроение юным зрителям создавали актеры театра людей и кукол «Чудаки», духовой оркестр Снеговиков, артист «Снежного шоу» Вячеслава Полунина – Андрей Климак.

Пожалуй, самым ярким и долгожданным событием стало появление Деда Мороза. Несмотря на расстояние, ему удалось вовлечь маленьких зрителей в интерактивный спектакль. По телефону он поговорил с юными пациентами, выслушал их новогодние желания, поздравил с наступающим Новым годом и пожелал всем самого главного – здоровья. Дети отвечали Морозу телефонными фонариками. В завершение представления перед зрителями зажглась надпись «Мы любим вас».

«Особое место в программах нашего Фонда отводится работе с детьми. Мы стараемся заботиться о них и оказывать всестороннюю помощь. Несмотря на то, что юные пациенты в онкологическом центре каждый день сталкиваются отнюдь не с детскими проблемами, они все равно остаются детьми. Проводя каждый год акцию «С миру по елке» мы хотим подарить детям положительные эмоции и ощущение новогодних чудес», – отметила генеральный директор Благотворительного фонда «ОМК-Участие» Юлия Мишина.

СПРАВКА
Акцию «С миру по елке» для детей, находящихся на лечении в онкоцентре, фонд «ОМК-Участие» организует ежегодно с 2012 года. Каждый год проект дополняется и расширяется, к участию присоединяются новые партнеры и волонтеры. В 2020 году новогоднее представление впервые прошло на расстоянии от зрителей.

Скачать

Инклюзивная выставка «Искусство быть вместе» проходит в Выксе

Выставка, соорганизатором которой стал Благотворительный фонд «ОМК-Участие», расположилась в Музее истории Выксунского металлургического завода (входит в состав ОМК). В экспозиции представлены 12 художественных работ, среди них — тактильные и звуковые интерактивные инсталляции, видеоарт-проекты. Пять работ выполнены в 2020 году специально для выставки в Выксе.

В связи с пандемией у выставки не было традиционного  торжественного открытия. Первыми вернисаж смогли увидеть представители Выксунской организации молодых инвалидов «Эдельвейс», инклюзивного центра семьи и детства «Созвездие», педагоги, жители Выксы, которые принимали участие в создании арт-объектов.

Фото предоставлено фондом «ОМК-Участие» Фото предоставлено фондом «ОМК-Участие» Фото предоставлено фондом «ОМК-Участие»

Выставка «Искусство быть вместе» – ключевое событие в программе инклюзивных мероприятий. В течение недели состоятся пять авторских экскурсий от жителей города по памятным для них местам, в течение сентября запланированы экскурсии для слабослышащих людей с переводом на русский жестовый язык, слабовидящих, людей с ментальными особенностями и для маломобильных посетителей. Также пройдут онлайн круглые столы по инклюзии и обмену опытом в создании равных возможностей для людей с инвалидностью и без.

Как пояснила АСИ генеральный директор БФ «ОМК-Участие» Юлия Мишина, одна из его задач – формирование в Выксе территории равных возможностей, равного доступа всех людей, в том числе людей с инвалидностью, к культуре.

«Такие проекты, как «Искусство быть», помогают людям с разными возможностями здоровья одинаково активно включаться в мир культуры, открывать для себя новые горизонты. В создании экспозиции приняли участие многие люди с инвалидностью, которые становились творцами современного искусства наравне с профессиональными художниками. В том числе и в этом проявляется инклюзия», — отметила Мишина.

Выставка будет работать в Выксе до конца октября.

Инклюзивный проект «Искусство быть», ставший в 2019 году победителем конкурса «Музей 4.0» программы «Музей без границ» Благотворительного фонда Владимира Потанина, организован Государственным центром современного искусства (ГЦСИ, Москва) и Благотворительным фондом помощи тяжелобольным людям «Гольфстрим».

«Мы очень признательны БФ «Гольфстрим», ГЦСИ и всем художникам за то, что они поднимают вопросы создания качественной инклюзивной среды», — добавила Мишина.

Подписывайтесь на телеграм-канал АСИ.

Больше новостей некоммерческого сектора в телеграм-канале АСИ. Подписывайтесь.

Виктор Щетков — биография, личная жизнь, фото, новости, «Студия СОЮЗ», жена, «Инстаграм» 2021

Биография

Если в России перестанут сочинять песни с нелепыми текстами, Виктор Щетков потеряет работу. А пока этого не произошло, комик еженедельно веселит народ, устраивая невероятно смешное шоу с участием звезд.

Детство и юность

Телеведущий родился 7 мая 1984 года. С ранних лет будущий креативный продюсер радовал родителей самыми неожиданными талантами. В детстве Витя любил петь — музыка ему была близка, хотя он так и не получил образование в этой сфере искусства.

Мальчик играл на баяне и гитаре — впоследствии близкое знакомство с инструментами помогло в армии, когда нужно было коротать время в казармах. А вот семья комика относилась к увлечению сына скептически.

Виктор Щетков в молодости

После музыкального периода школьник заинтересовался спортом. Витя пробовал себя в борьбе, но больше ему нравились командные игры. В итоге остановился на баскетболе. В интервью Щетков признавался — ему нравилось следить за карьерой Майкла Джордана.

Однажды он увидел игру кумира на чемпионате и решил во что бы то ни стало научиться так же виртуозно владеть мячом. И хоть баскетбол и не стал делом жизни комика, он и сейчас в любую свободную минуту тренируется, даже участвует в различных турнирах. А в своем инстаграм-аккаунте юморист в шапке профиля написал: «рост 170 см — стремлюсь в NBA».

В школе же Витя ничем не выделялся среди сверстников. Примерно с 5-го класса ученик понял, что хотел бы стать милиционером. Получив аттестат, вполне ожидаемо выбрал Тюменский юридический институт. Абитуриент без труда сдал вступительные экзамены и стал студентом административно-правового факультета.

Но уже в институте Щетков почувствовал желание блистать на сцене. В молодости числился в местной команде «Гарвард» и в этом составе успел поучаствовать в Премьер-лиге. Впрочем, тогда снискать славу юмориста Виктору не удалось.

Тем временем, получив высшее образование, молодой человек решил пойти работать по специальности. И целых 3 года трудился в правоохранительных органах. Интересно, что в первый рабочий день выпускник юридического института поймал преступника, находящегося в федеральном розыске.

Однако душа уроженца города Тюмени не лежала к этой сфере. Он продолжал участвовать в КВН, к тому времени его команда объединилась с «Молью» из Шадринска. Так на сцене появился «Союз», дебютировавший на фестивале в Сочи.

Юмор и творчество

Судьба коллектива «Союз» разительно изменила профессиональную биографию юмориста. В составе команды он дошел до финала и даже стал чемпионом Высшей лиги. На сцене Щетков примерил роль персонажа, в обязанности которого входило объявление музыкальных номеров, и, собственно, пение.

К 2014 году «Союз» перестал участвовать в регулярных играх, при этом продолжал выходить на сцену во время проведения крупных фестивалей. Уроженец Тюмени и его коллеги — Александр Алымов и Айдар Гараев — расширили сферу деятельности: помимо внутриклубных выступлений стали сотрудничать с другими командами. Виктор также писал сценарии для телевизионных шоу.

Александр Алымов, Артем Муратов, Елена Гущина, Виктор Щетков и Айдар Гараев в шоу «Студия СОЮЗ»

Прорыв в карьере обозначился, когда выпускнику административно-правового факультета пришла в голову идея музыкальной передачи. Произошло это прозаично — молодой человек ехал на работу, слушая и пытаясь вникнуть в смысл очередного «перла» из русской «попсы». И подумал: было бы интересно построить на этом соревнование, когда участникам приходилось бы отгадывать слова из текстов песен, основываясь исключительно на интуиции, ритме и рифме.

Виктор поделился мыслью с коллегами, и те поддержали инициативу. 10 августа на канале ТНТ состоялась премьера передачи «Студии СОЮЗ». Трудились над созданием программы, кроме Щеткова, Гараева и Алымова, генеральный продюсер ТНТ Вячеслав Дусмухаметов, а также Кирилл Коковкин и Максим Морозов.

Программа объединила в себе сразу несколько жанров — импровизационный, музыкальный и юмористический. Задумка проекта сводилась не только к тому, чтобы проверить таланты приглашенных звезд, но и посмеяться над абсурдными композициями малоизвестных представителей русской «попсы».

Популярность ведущих шоу росла. Их было несколько — кроме Щеткова, Коковкина, Гараева и Алымова проверяли музыкальные способности гостей Артем Муратов и Елена Гущина. Нередко Виктора приглашали для участия в других проектах ТНТ и прочих юмористических передачах. Так, уроженец Тюмени вместе с биатлонистом Антоном Шипулиным в 2018 году побывал в программе Азамата Мусагалиева «Где логика?».

Также и участники других комедийных проектов на ТНТ приходили проверить свою интуицию и вокальные данные в «Студию СОЮЗ». В 2020 году гостями шоу стали коллеги — резиденты «Импровизации» Сергей Матвиенко, Арсений Попов, Дмитрий Позов и Антон Шастун. Фото Щеткова с Шастуном и Поповым стало мемом в Сети.

Личная жизнь

Актер-комик женат. Счастливое событие состоялось 11 августа 2015 года. Жена юмориста — Юлия Мишина, профессионально занимается фотографией. Познакомились они как раз на работе. Девушка снимала участников команды КВН «Союз» во время Премьер-лиги.

Виктор Щетков и его жена Юлия Мишина

Уже тогда ей понравился Виктор. Избранник же в интервью рассказал — до встречи с Юлией он скептически относился к рассказам о «любви с первого взгляда». Тут же молодому человеку пришлось в корне пересмотреть свою точку зрения, настолько Мишина запала ему в душу.

Пока детей у супругов нет, поэтому они наслаждаются возможностью быть вдвоем, стараясь уделять личной жизни больше времени. В инстаграм-аккаунте комика множество совместных фото с женой из путешествий. В 2020 году влюбленные исполнили мечту — купили дом.

Виктор Щетков сейчас

Пандемия коронавирусной инфекции напрямую коснулась юмориста. Осенью 2020 года мужчина даже лежал в больнице с поражением легких. К счастью, телеведущий сумел побороть недуг и вернуться к съемкам новых эфиров «Студии СОЮЗ» на ТНТ.

Начало 2021 года не позволило уроженцу Тюмени расслабиться. Сразу после праздников он принял участие в передаче «Где логика?» вместе с Дмитрием Позовым. Затем Виктор и Айдар Гараев поспешили рассмешить зрителя в «Анекдот-шоу» с Вадимом Галыгиным.

Щетков продолжает заниматься ремонтом нового дома, параллельно придумывая новые конкурсы и шутки для «Студии СОЮЗ».

Резюме «Модель, фотомодель», Одесса. Мишина Юлия — Work.ua

Резюме от 26 сентября 2017 PRO

Модель, фотомодель, 5 000 грн

Неполная занятость.

Возраст:
27 лет
Город:
Одесса

Соискатель указал телефон, эл. почту и адрес.

Получить контакты этого кандидата можно на странице https://www.work.ua/resumes/4250422/


Опыт работы

Модель, фотомодель

с 01.2009 по 01.2014 (5 лет)
Арт Подиум, Одесса (Модельное агенство)


Образование

Международный Гуманитарный Университет

Правознавство, Одесса
Высшее, с 2010 по 2016 (5 лет 8 месяцев)


Сравните свои требования и зарплату с вакансиями других компаний:

О МНЕ

Думаю, было бы лучше описывать себя через то, что я люблю 🙂 Это: востоковедение (моя невероятная специальность!), Изучение иностранных языков, китайская философия и история, музыка, литература, лингвистика, психология, телесериалы и фильмы, живые концерты, катание на коньках, езда на велосипеде, мой университет, покупки, кошки, путешествия, обучение по обмену и т. д.

Почему я занимаюсь Couchsurfing

КАК Я УЧАСТВУЮ В КУЧСЕРФИНГЕ

В настоящее время я не могу никого принимать, но всегда ухватываюсь за возможность показать людям Тайбэй и послушать рассказы путешественников 🙂

ОПЫТ КУЧСЕРФИНГА

Я трижды занимался каучсерфингом, когда был в Китае и Южной Корее, и во всех трех случаях это был потрясающий опыт — такой хороший шанс встретить гостеприимных, умных и веселых людей! И, если бы не Couchsurfing, я бы много чего не знал 🙂

Интересы

Изучение языков — моя самая большая страсть, поэтому я всегда рада познакомиться с людьми из разных стран и узнать больше об их менталитете, культуре и языке.

  • кошек
  • Культура
  • литература
  • концертов
  • покупки
  • фильмы
  • телевизор
  • путешествие
  • легковых автомобилей
  • общение
  • музыка
  • велоспорт
  • история
  • языков
  • психология

Музыка, фильмы и книги

Я без ума от чтения, поэтому читаю практически все книги, которые попадаются мне в руки 🙂 Особенно мне нравятся английские, французские и китайские романы.

стран, в которых я побывал

Китай, Кипр, Чехия, Египет, Франция, Германия, Израиль, Польша, Португалия, Южная Корея, Турция

стран, в которых я жил

Китай, Российская Федерация, Тайвань

Фамилия Мишина

Имена для Мишина

  • Юки Мишина 4
  • Юкико Мишина 4
  • Юки Мишина 4
  • Регина Мишина 4
  • Мики Мишина 4
  • Лилия Мишина 4
  • Иришка Мишина 4
  • Ириша Мишина 4
  • Ириша Мишина 4 4
  • Ирина Мишина 4
  • Ира Мишина 4
  • Инна Мишина 4
  • Инесса Мишина 4
  • Хироюки Мишина 4
  • Хирото Мишина 4
  • Хироши Мишина 4
  • Хироми Мишина 4
  • Хироко Мишина 4
  • Хироко Мишина 4 4
  • Хирока Мишина 4
  • Хина Мишина 4
  • Хидеказу Мишина 4
  • Хельга Мишина 4
  • Елена Мишина 4
  • Хаято Мишина 4
  • Харука Мишина 4
  • Галя Мишина 4
  • Галина Мишина 4
  • Галина Мишина 4 4
  • Ая Мишина 4
  • Аяка Мишина 4
  • Анна Мишина 4
  • Юкари Ми shina 3
  • Наталья Мишина 3
  • Наталья Мишина 3
  • Надя Мишина 3
  • Надежда Мишина 3
  • Марико Мишина 3
  • Любовь Мишина 3
  • Кристина Мишина 3
  • Юлия Мишина 3
  • Jelena Мишина 3
  • Эйкичи Мишина 3
  • Анастасия Мишина 3
  • Анастасия Мишина 3
  • Алла Мишина 3
  • Александра Мишина 3
  • Зоя Мишина 2
  • Злата Мишина 2
  • 2
  • Женя Мишина
  • Мишина
  • Женя Мишина
  • Мишина 2
  • Юта Мишина 2
  • Юна Мишина 2
  • Юми Мишина 2
  • Юмико Мишина 2
  • Юля Мишина 2
  • Юлия Мишина 2
  • Юлия Мишина 2
  • Юко Мишина 2
  • Мишина 2
  • Юко Мишина 2
  • Мишина
  • Мишина 2
  • Юка Мишина 2
  • Юко Мишина 2
  • Юхей Мишина 2 9 0026
  • Йота Мишина 2
  • Йошиюки Мишина 2
  • Йошитака Мишина 2
  • Йошинори Мишина 2
  • Йошико Мишина 2
  • Йошихиро Мишина 2
  • Йошихико Мишина 2
  • Йоши Мишина 2
  • Мишина 2 Йоши Мишина 2 Йоши Мишина 2 Йоши Мишина 2 Йоши Мишина 2 Йоши Мишина 2
  • Елена Мишина 2
  • Ясуюки Мишина 2
  • Ясуко Мишина 2
  • Яна Мишина 2
  • Влада Мишина 2
  • Виталина Мишина 2
  • Виктория Мишина 2
  • Виктория Мишина 2
  • Вида Мишина 2
  • Виктория Мишина 2
  • Виктория
  • Виктория Мишина 2
  • Вероника Мишина 2
  • Вера Мишина 2
  • Василиса Мишина 2
  • Варвара Мишина 2
  • Валя Мишина 2
  • Валерия Мишина 2
  • Валерия Мишина 2
  • Валентина Мишина 2
  • Валентина Мишина
  • Ульяна Мишина 2
  • Цутому Мишина 2
  • 900 25 Тосики Мишина 2
  • Тору Мишина 2
  • Томойо Мишина 2
  • Томоя Мишина 2
  • Томоми Мишина 2
  • Томоко Мишина 2
  • Томоки Мишина 2
  • Томохиро Мишина 2
  • Тина Мишина 2
  • Тина Мишина 2
  • Теруко Мишина 2
  • Татьяна Мишина 2
  • Татьяна Мишина 2
  • Тати Мишина 2
  • Татьяна Мишина 2
  • Танюшка Мишина 2
  • Таня Мишина 2
  • Тамара Мишина 2
  • Такуя Мишина 2
  • Такуя Мишина 2 Такуя Мишина 2 Такуя Мишина 2
  • Такаяки Мишина 2
  • Такаши Мишина 2
  • Такао Мишина 2
  • Таканори Мишина 2
  • Такахиро Мишина 2
  • Такааки Мишина 2
  • Тадаси Мишина 2
  • Светлана Ситлана Мишина 2
  • Мишина
  • Светлана Мишина 2
  • Света Мишина 2
  • Софья Мишина 2
  • Софья Мишина 2
  • София Мишина 2
  • Снежана Мишина 2
  • Шото Мишина 2
  • Шо Мишина 2
  • Шохей Мишина 2
  • Шиори Мишина 2
  • Шинобу Мишина 2
  • Серафима Мишина 2
  • Саюри
  • Сайина 2
  • Саюри Мишина 2
  • Сатоши Мишина 2
  • Саша Мишина 2
  • Саори Мишина 2
  • Саки Мишина 2
  • Сачи Мишина 2
  • Сатико Мишина 2
  • Рютаро Мишина 2
  • Риота Мишина 2
  • Рио Мишина 2
  • Рио Мишина 2
  • Рио Мишина 2
  • Рита Мишина 2
  • Рина Мишина 2
  • Рику Мишина 2
  • Рие Мишина 2
  • Раиса Мишина 2
  • Полина Мишина 2
  • Оксана Мишина 2
  • Оля Мишина 2
  • Ольга Мишина 2
  • Олеся Мишина
  • Олечка Мишина 2
  • Ола Мишина 2
  • Оксана Мишина 2
  • Норио Мишина 2
  • Нобуюки Мишина 2
  • Нобуо Мишина 2
  • Нобухиро Мишина 2
  • Нина Мишина 2
  • Ника Мишина 2
  • Нацуми Мишина 2
  • Нацуки Мишина 2
  • Наташка Мишина 2
  • Наташа25 Нишина 2
  • Мишина 2 Наталья Мишина 2
  • Наталья Мишина 2
  • Наталия Мишина 2
  • Натали Мишина 2
  • Настя Мишина 2
  • Настя Мишина 2
  • Настя Мишина 2
  • Настасья Мишина 2
  • Наоя
  • Мишина 2
  • Наоя Мишина 2 Наоя Мишина 2 Наоми Мишина 2
  • Наоко Мишина 2
  • Наоки Мишина 2
  • Надя Мишина 2
  • Надин Мишина 2
  • Надежда Мишина 2
  • Мунетоши Мишина 2
  • Момоко Мишина 2
  • Мицуаки Мишина 2
  • Мицуаки Мишина 2
  • Мицуаки Мишина 2 Мишаня Мишина 2
  • Миша Мишина 2
  • Мина Мишина 2
  • Ми лана Мишина 2
  • Мила Мишина 2
  • Мику Мишина 2
  • Мика Мишина 2
  • Миеко Мишина 2
  • Мичико Мишина 2
  • Майя Мишина 2
  • Маю Мишина 2
  • Майя Мишина 2
  • Мас26 Мишина 2
  • Мишина 2
  • Мас26 Маша Мишина 2
  • Масаюки Мишина 2
  • Масато Мишина 2
  • Масао Мишина 2
  • Масако Мишина 2
  • Масаки Мишина 2
  • Масахиро Мишина 2
  • Мария Мишина 2
  • Мария Мишина 2
  • Маришка 2
  • Маришка 2
  • Маришка Марина Мишина 2
  • Мари Мишина 2
  • Марианна Мишина 2
  • Мария Мишина 2
  • Маргарита Мишина 2
  • Макико Мишина 2
  • Май Мишина 2
  • Мачико Мишина 2
  • Людмила Мишина 2
  • Людмила Мишина 2
  • Людмила Мишина 2
  • Людмила Мишина Люда Мишина 2
  • Лиза Мишина 2
  • Лиза Мишина 2
  • Лилия Мишина 2
  • Лидия Мишина 2
  • Лерой Мишина 2
  • Лера Мишина 2
  • Лена Мишина 2
  • Лариса Мишина 2
  • Лара Мишина 2
  • Киоко Мишина 2
  • Кунио Мишина 2
  • Куми Мишина 2
  • Куми Мишина 2
  • Ксюша Мишина 2
  • Ксюша Мишина 2
  • Ксения Мишина 2
  • Ксения Мишина 2
  • Ксения Мишина 2
  • Котару Мишина 2
  • Кота Мишина 2
  • Кира Мишина 2
  • Кения Мишина 2
  • Кения Мишина 2
  • Кейсуке Мишина 2
  • Кейко Мишина 2
  • Казуюки Мишина 2
  • Казуя Мишина 2
  • Кадзуми Мишина 2
  • Казумаса Мишина 2
  • Казухиро Мишина 2
  • Кайо Мишина 2
  • Катина 2 Катя Мишина 2
  • Катя Мишина 2
  • Катя
  • Катя Мишина 2
  • Катерина Мишина 2
  • Катя Мишина 2
  • Карина Мишина 2
  • Каору Мишина 2
  • Каори Мишина 2
  • Кана Мишина 2
  • Канаэ Мишина 2
  • Кахо Мишина 2
  • Юрий Мишина 2
  • Джунко Мишина 2
  • Жанна Мишина 2
  • Джейн Мишина 2
  • Ирина Мишина 2
  • Ипина Мишина 2
  • Иннеля Мишина 2
  • Инга Мишина 2
  • Инес Мишина 2
  • Илоночка Мишина 2
  • Илона Мишина 2
  • Икуэ Мишина 2
  • Хисаши Мишина 2
  • Хисаши Мишина 2
  • Хисаши Мишина
  • Хиротака Мишина 2
  • Хиро Мишина 2
  • Хиромаса Мишина 2
  • Хироаки Мишина 2
  • Хидеюки Мишина 2
  • Хидэтоши Мишина 2
  • Хидео Мишина 2
  • Хиденлеори Мишина 2
  • Хелла Мишина
  • Хелла Мишина
  • Хадзуки Мишина 2
  • Харуму Мишина 2
  • Георгий Мишина 2
  • Гаяне Мишина 2
  • Галочка Мишина 2
  • Галиина Мишина 2
  • Фумио Мишина 2
  • Евгения Мишина 2
  • Евгения Мишина 2
  • Эри Мишина 2
  • Эрико Мишина 2
  • Эрика Мишина 2
  • Эльвира
  • Эрика Мишина 2
  • Эльза Мишина 2
  • Елизавета Мишина 2
  • Елизавета Мишина 2
  • Елен Мишина 2
  • Елена Мишина 2
  • Эдди Мишина 2
  • Дина Мишина 2
  • Диана Мишина 2
  • Даша Мишина 2
  • Даша Мишина 2
  • Даша Мишина 2 Мишина 2
  • Дарья Мишина 2
  • Кристина Мишина 2
  • Кристина Мишина 2
  • Чисато Мишина 2
  • Чика Мишина 2
  • Тихиро Мишина 2
  • Тихару Мишина 2
  • Чиаки Мишина 2
  • Екатерина Мишина 2
  • Екатерина Мишина 2 Мишина 2
  • Аюми Мишина 2
  • Аяно Мишина 2
  • Ацуши Мишина 2
  • Ацуко Мишина 2
  • Ася Мишина 2
  • Аска Мишина 2
  • Ариса Мишина 2
  • Арина Мишина 2
  • Аой Мишина 2
  • Анюта Мишина 2
  • Аня Мишина 2
  • Антонина Мишина 2
  • Антонина Мишина 2 2
  • Аниса Мишина 2
  • Ангелина Мишина 2
  • Ангела Мишина 2
  • Анечка Мишина 2
  • Андрей Мишина 2
  • Анастасия Мишина 2
  • Ана Мишина 2
  • Алена Мишина 2
  • Алису Мишина 2
  • Алису Мишина 2 2
  • Алия Мишина 2
  • Алиса Мишина 2
  • Алена Мишина 2
  • Алина Мишина 2
  • Алексей Мишина 2
  • Алеся Мишина 2
  • Аленка Мишина 2
  • Александра Мишина 2
  • Альбина Мишина 2
  • 2
  • Акиёси Мишина 2
  • Акира Мишина 2
  • Акико Мишина 2
  • Акихиро М ишина 2
  • Зина Мишина
  • Зинаида Мишина
  • Женечка Мишина
  • Зара Мишина
  • Загорская Мишина
  • Юя Мишина
  • Юто Мишина
  • Юсуке Мишина
  • Юки Мишина
  • Юки Мишина Юки Мишина Юки Мишина Юки Мишина Юки Мишина Юки Мишина
  • Юрий Мишина
  • Юляшка Мишина
  • Юлианна Мишина
  • Юлиана Мишина
  • Юленька Мишина
  • Юкн Мишина
  • Юкина Мишина
  • Юитен Мишина
  • Юки Мишина
  • Юки Мишина
  • Юхки Мишина
  • Юхки Мишина
  • Ючи Мишина
  • Йоджи Мишина
  • Йоичи Мишина
  • Йосуке Мишина
  • Йоширо Мишина
  • Йошио Мишина
  • Йошими Мишина
  • Йошики Мишина
  • Йошихару Мишина
  • Йорико
  • Иоланда Мишина
  • Йоичи Мишина
  • Йосуке Мишина
  • Юлия Мишина
  • Юлия Мишина
  • Евгения Мишина
  • Яёи Мишина
  • Яся Мишина
  • Ясутиш
  • Йасутиш
  • Мишина
  • Йасутака
  • Мишина
  • Йасутиш
  • Ясутака 25 Мишина
  • Ясенка Мишина
  • Яноха Мишина
  • Яэ Мишина
  • Зевер Мишина
  • Ксения Мишина
  • Ксения Мишина
  • Хельга Мишина
  • Вакана Мишина
  • Владлена Мишина
  • Владислава Мишина
  • Мишина
  • Владислава25 Мишина
  • Владислава 25 Мишина
  • Владислава 25 Мишина
  • Виолетта Мишина
  • Виола Мишина
  • Викуся Мишина
  • Викусик Мишина
  • Виктория Мишина
  • Виктория Мишина
  • Вики Мишина
  • Вероничка Мишина
  • Вероника М Ишина
  • Вербена Мишина
  • Вераника Мишина
  • Венера Мишина
  • Велена Мишина
  • Василий Мишина
  • Варя Мишина
  • Валюша Мишина
  • Вал Мишина
  • Валерий Мишина
  • Улица
  • Ура
  • Tsuyoshi Mishina
  • Tsubasa Mishina
  • Tosinori Mishina
  • Toshiya Mishina
  • Toshio Mishina
  • Toshinori Mishina
  • Toshimasa Mishina
  • Toshiko Mishina Mishina
  • Toshikazu
  • Toshiko Mishina
  • Toshikazu
  • Toshiko Mishina
  • Toshikazu
  • Мишина
  • Томонори Мишина
  • Томонари Мишина
  • Томоэ Мишина
  • Томиёси Мишина
  • Томиясу Мишина
  • Тома Мишина
  • Текла Мишина
  • Тецуро Мишина
  • 900 25 Татьяна Мишина
  • Терренс Мишина
  • Терезе Мишина
  • Таюшка Мишина
  • Тая Мишина
  • Тацузо Мишина
  • Тацуя Мишина
  • Тацуро Мишина
  • Тацуки Мишина
  • Татсиана Мишина
  • Татсиана Мишина
  • Татсиана Мишина
  • Татсиана Мишина
  • Татсиана Мишина
  • Татсиана Мишина
  • Мишина
  • Танюша Мишина
  • Танечка Мишина
  • Тамилла Мишина
  • Такутон Мишина
  • Такуто Мишина
  • Такуро Мишина
  • Такума Мишина
  • Такэхиро Мишина
  • Тайджина Мишина
  • Такамаса Мишина Мишина Такамаса Мишина Такамаса Мишина Мишина Такамаса Мишина Такамаса Мишина Мишина Такамаса Мишина
  • Тайчи Мишина
  • Тадаюки Мишина
  • Таданобу Мишина
  • Светланка Мишина
  • Сунаэ Мишина
  • Сумихару Мишина
  • Стелла Мишина
  • Соня Мишина
  • Соня Мишина 9002 6
  • Софи Мишина
  • Шурка Мишина
  • Сюнсуке Мишина
  • Шу Мишина
  • Шуичи Мишина
  • Шухей Мишина
  • Показать Мишина
  • Шотаро Мишина
  • Сёго Мишина
  • Шин Мишина
  • Шин 25 Шин Мишина
  • Шин 25 Шина Мишина Шин 25 Шина Мишина Сигето Мишина
  • Сигэру Мишина
  • Сигэри Мишина
  • Шифуми Мишина
  • Шерри Мишина
  • Сейя Мишина
  • Сейджи Мишина
  • Сайоко Мишина
  • Сая Мишина
  • Сатсуки Саториш Мишина
  • Сатсуки Саториш Мишина Сатсуки Саториш Мишина
  • Сатой Мишина
  • Сашка Мишина
  • Сара Мишина
  • Санаэ Мишина
  • Сакико Мишина
  • Сакаэ Мишина
  • Сабрина Мишина
  • Рюусей Мишина
  • Рюусаку Мишина
  • Ры uji Mishina
  • Ryuichi Mishina
  • Ryousuke Mishina
  • Ryosuke Mishina
  • Ruslana Mishina
  • Ruri Mishina
  • Ruriko Mishina
  • Ruiki Mishina
  • Roza Mishina
  • Rodney Mishina
  • Rodney Mishina Rodney Mishina Rodney Mishina Rodney Mishina Rodney Mishina
  • Рири Мишина
  • Рион Мишина
  • Рио Мишина
  • Рихо Мишина
  • Риеко Мишина
  • Резетта Мишина
  • Рейнольд Мишина
  • Рамина Мишина
  • Рамиля Мишина
  • Рада 25 Мишина
  • Рада25 Мишина Рада25 Мишина Пхаттарайон Мишина
  • Петк Мишина
  • Пенка Мишина
  • Полина Мишина
  • Оли Мишина
  • Ольга Мишина
  • Олька Мишина
  • Оля Мишина
  • Оленка Мишина
  • Нориюки Нориюки Мишина
  • иёши Мишина
  • Нориаки Мишина
  • Нора Мишина
  • Нобуйо Мишина
  • Нобуко Мишина
  • Нинна Мишина
  • Нилина Мишина
  • Никуля Мишина
  • Нгуен Мишина
  • Натсу
  • Нэля Мишина
  • Нэля Нэля
  • Натсу
  • Нэля Нэля
  • Наталия Мишина
  • Нателла Мишина
  • Наталия Мишина
  • Наталия Мишина
  • Настюша Мишина
  • Настюша Мишина
  • Настя Мишина
  • Настенко Мишина
  • Настенька Мишина Настенька Мишина Настенька Мишина Настенька Мишина
  • Настенька Мишина
  • Нао Мишина
  • Нанси Мишина
  • Наирочка Мишина
  • Нахоко Мишина
  • Надюшка Мишина
  • Надежда Мишина
  • Мотоаки Мишина
  • Мориаки Мишина
  • Моника Мишина
  • 900 25 Молли Мишина
  • Моэ Мишина
  • Мию Мишина
  • Миёко Мишина
  • Митзи Мишина
  • Мицуко Мишина
  • Мицуки Мишина
  • Мицухиро Мишина
  • Мицухико Мишина
  • Мисишка Мисишка Мисишка Мисишка Мисишка Мисузу Мисишка Мисузу
  • Мисузу
  • Мишина
  • Мисато Мишина
  • Мисао Мишина
  • Мира Мишина
  • Минна Мишина
  • Милена Мишина
  • Милаша Мишина
  • Микако Мишина
  • Михо Мишина
  • Мидори Мишина
  • Мичио Мишина
  • Мичио 25 Мишина Мичио 25 Мишина
  • Маюми Мишина
  • Машуля Мишина
  • Машка Мишина
  • Масатоши Мишина
  • Масанори Мишина
  • Масамиту Мишина
  • Масами Мишина
  • Масамичи Мишина
  • Масакадзу Мишина
  • o Мишина
  • Масахару Мишина
  • Масаэ Мишина
  • Масачика Мишина
  • Масааки Мишина
  • Марьям Мишина
  • Маруся Мишина
  • Мартин Мишина
  • Марта Мишина
  • Мар Мишина
  • Маринка Мишина
  • Маринка Мишина Маринка Мишина Маринка Мишина Маринка Мишина
  • Маринка Мишина
  • Маринка Мишина
  • Марьяй Мишина
  • Марго Мишина
  • Маршал Мишина
  • Маня Мишина
  • Мана Мишина
  • Манами Мишина
  • Мамору Мишина
  • Мамию Мишина
  • Мами Мако Мишина
  • Мамико Мишина
  • Мамико Мишина
  • Мамико Мишина
  • Майя Мишина
  • Майто Мишина
  • Майко Мишина
  • Майка Мишина
  • Махито Мишина
  • Маххи Мишина
  • Мааса Мишина
  • Люба Мишина
  • Лёлечка Мишина
  • Lynnell Mishina
  • Lynnell Mishina 5 Людмила Мишина
  • Ляля Мишина
  • Луиза Мишина
  • Любовь Мишина
  • Любаша Мишина
  • Лоретталорна Мишина
  • Лола Мишина
  • Любовь Мишина
  • Людмила Мишина
  • Людмила Мишина
  • Людмила Мишина
  • Людмила Мишина
  • Людмила Мишина
  • Людмила Мишина
  • Людмила Мишина
  • Людмила Мишина
  • Людмила Мишина
  • Людмила Мишина
  • Мишина
  • Лиля Мишина
  • Лилит Мишина
  • Лили Мишина
  • Лика Мишина
  • Лийса Мишина
  • Лида Мишина
  • Лиана Мишина
  • Лейли Мишина
  • Леона Мишина
  • Ленуська Мишина
  • Ленуська Мишина Ленуська Мишина Ленуська Мишина Ленуська Мишина Ленуська Мишина
  • Лана Мишина
  • Лалита Мишина
  • Лада Мишина
  • Куу Мишина
  • Куренай Мишина
  • Кунико Мишина
  • Ксений Мишина
  • Ксана Мишина
  • Кристя Мишина
  • Кристиночка
  • Кристинка Мишина
  • Кристи Мишина
  • Кодзуэ Мишина
  • Кодзо Мишина
  • Коута Мишина
  • Коуки Мишина
  • Кодзи Мишина
  • Коичи Мишина
  • Коухей Мишина
  • Коджи
  • Кокей
  • Коухи Мишина
  • Коджи
  • Кокей
  • Коухи Мишина
  • Коджи
  • Кокей
  • Кокей Мишина
  • Мишина
  • Кохеи Мишина
  • Клара Мишина
  • Киётака Мишина
  • Киёэ Мишина
  • Кимико Мишина
  • Кимиаки Мишина
  • Кико Мишина
  • Керми Мишина
  • Кента Кейш Мишина
  • Кента25 Кенсина Мишина
  • Кин Мишина
  • Казухеро Мишина
  • Кайоко Мишина
  • Кавори Мишина
  • Катюня Мишина
  • Кэти Мишина
  • Катюша Мишина
  • Кацуюки Мишина
  • Кацуми Мишина
  • Кацуми ина
  • Катрина Мишина
  • Катк Мишина
  • Кат Мишина
  • Катя Мишина
  • Кэти Мишина
  • Кэти Мишина
  • Кэтлин Мишина
  • Катерина Мишина
  • Катя Мишина
  • Карина Мишина Карина Мишина Карина Мишина Карина Мишина Карина Мишина Карина Мишина Карина Мишина Кашина Мишина
  • Камелия Мишина
  • Кахори Мишина
  • Джастин Мишина
  • Джунья Мишина
  • Джунджи Мишина
  • Юничи Мишина
  • Юлия Мишина
  • Юли Мишина
  • Джульета Мишина
  • Джулианна Мишина
  • Джулианна Мишина Джулианна Мишина Юлианна Мишина Юлианна Мишина Юлианна Мишина Мишина
  • Женя Мишина
  • Дженни Мишина
  • Жанна Мишина
  • Хавьер Мишина
  • Яна Мишина
  • Ядвига Мишина
  • Ивон Мишина
  • Юлия Мишина
  • Иссей Мишина
  • Исанна Мишина
  • Ирсан Мишина
  • Ирма Мишина
  • Ина Мишина
  • Хонока Мишина
  • Хонами Мишина
  • Хитоми Мишина
  • Хитое Мишина
  • Гули Мишина
  • Гульфиджа Мишина
  • Гольфиша
  • Мишина
  • Гульфиджа Мишина
  • Гильдия
  • Гульфиджа Мишина
  • Мишина
  • Горо Мишина
  • Фуюко Мишина
  • Футоши Мишина
  • Фумиё Мишина
  • Фумия Мишина
  • Фумино Мишина
  • Фуми Мишина
  • Фуми Мишина
  • Фредерика Мишина
  • Мишина
  • Мишина
  • Фредерика Мишина
  • Мишина
  • Евгений Мишина
  • Евдокия Мишина
  • Ева Мишина
  • Эрий Мишина
  • Эмико Мишина
  • Эльза Мишина
  • Элина Мишина
  • Элеонора Мишина
  • Еленка Мишина
  • Эла Мишина
  • 5 Эйши Мишина
  • Эйко Мишина
  • Эльвира Мишина
  • Ефимия Мишина
  • Динара Мишина
  • День Мишина
  • Дашуля Мишина
  • Дашенка Мишина
  • Дарила Мишина
  • Дарла Мишина Дарла Мишина Дарла Мишина Дарла Мишина Дарла Мишина Дарла Мишина Дарла Мишина Дарла Мишина Мишина
  • Cvetlana Mishina
  • Corie Mishina
  • Cika Mishina
  • Chinatsu Mishina
  • Chikara Mishina
  • Chieko Mishina
  • Chico Mishina
  • Ches Mishina
  • Caressa Bijanina
  • Moryish
  • Caressa Bijanina
  • Moryish
  • Caressa Bijanina
  • Moryish
  • Берта Мишина
  • Белен Мишина
  • Бекки Мишина
  • Барбара Мишина
  • Айике Мишина
  • Ацуми Мишина
  • Астерия Мишина
  • Азия Мишина
  • Эшли Мишина
  • Асами Мишина 9 0026
  • Аринка Мишина
  • Арцей Мишина
  • Арата Мишина
  • Анжела Мишина
  • Анютка Мишина
  • Любой Мишина
  • Анюта Мишина
  • Антония Мишина
  • Аннута Мишина
  • Анжелика Анжелика
  • Ангелочка Мишина
  • Анжелика Андроника Мишина
  • Андреса Мишина
  • Анатали Мишина
  • Анастасия Мишина
  • Анастасия Мишина
  • Анастасий Мишина
  • Амира Мишина
  • Амина Мишина
  • Амели Мишина
  • Алина Мишина
  • Алина Мишина
  • Алина Мишина
  • Аленка
  • Аленка
  • Аленка Мишина
  • Алина Мишина
  • Алинка Мишина
  • Али Мишина
  • Аликсандра Мишина
  • Алиса Мишина
  • Алия Мишина
  • Альфия Мишина
  • Алевтина Мишина
  • Алеся Мишина
  • Аленчик Мишина
  • Алена Мишина
  • Ако Мишина
  • Акино Мишина
  • Акихико Мишина
  • Акари Мишина
  • Айри Мишина
  • Айра Мишина
  • Айгерим Мишина
  • Аглая Мишина
  • Миссина Мишина Миссия Мишина
  • Аделиа Мишина Миссия Мишина , mihsina, mishin, mishinaa, mishins, moshona, mishinae, mishinai, mishinao, mishinna

    Лучшие изображения для Mishina

    Подобные имена


    Fishina / Tishina / Rishina / Gishina / Kishina / Mishini / Lishina / Vishine / Pish00ina 6 обвиняется в мошенничестве в Интернете на сумму 4 миллиона долларов, связанном с поддельными продажами автомобилей через Интернет

    ЛОС-АНДЖЕЛЕС — Федеральное большое жюри предъявило обвинение шести иностранным гражданам по обвинениям, связанным со схемой продаж через Интернет, которая якобы обманывала американцев, которые пытались приобрести автомобили и другие транспортные средства в Интернете через веб-сайты в том числе eBay Motors, Auto Trader, Yahoo Auto, Edmunds.com и Craigslist.

    В обвинительном заключении с 24 пунктами, которое было возвращено в среду днем, говорится о схеме, по которой автомобили предлагались к продаже на различных законных веб-сайтах. Впоследствии деньги были собраны у жертв по всей территории Соединенных Штатов и якобы помещены на счета условного депонирования в PayPal и eBay Motors. Затем деньги были выведены со счетов, и миллионы долларов были отправлены в Европу. Согласно обвинительному заключению, ни одна машина не была доставлена ​​сотням жертв, которые потеряли более 4 миллионов долларов за три с половиной года действия схемы.

    Обвинения являются результатом расследования, проведенного Службой расследований внутренней безопасности США (HSI) Иммиграционной и таможенной полиции (ICE), Отделом уголовных расследований налоговой службы (IRS) и Секретной службой США. Несколько других государственных и местных правоохранительных органов оказали существенную помощь в ходе расследования, в том числе полицейское управление Коста Меса.

    В обвинительном заключении утверждается сговор с целью совершения банковского и банковского мошенничества, девять пунктов обвинения в мошенничестве с использованием электронных средств, восемь пунктов обвинения в мошенничестве с банками, сговор с целью отмывания денег и четыре пункта обвинения в отмывании денег.Кроме того, обвинение требует конфискации имущества и денег, незаконно полученных с помощью этой схемы, в том числе более 4,2 миллиона долларов в валюте США. Если они будут признаны виновными по обвинению в обвинительном заключении, каждый из подсудимых будет приговорен к наказанию в виде сотен лет в федеральной тюрьме.

    Лица, обвиняемые в обвинительном заключении:

    • Корнелиу Стефан Вейкум, 37 лет, гражданин Румынии, проживающий в Берлине и в настоящее время находящийся под стражей в федеральных властях штата Невада;
    • Юлия Мишина-Хеффрон, 23 года, уроженка Екатеринбурга, Россия, находится под стражей федеральных властей в Неваде;
    • Сергей Бугаев, 38 лет, гражданин России, житель Берлина, который в настоящее время находится под стражей в округе Ориндж;
    • Александр Брем, 34 года, уроженец Казахстана, проживающий в Берлине;
    • Марина Талашкова, 24, г. Екатеринбург, Россия; и
    • Рихардс Авотиньш, 21 год, житель Латвии.

    «По мере того, как все больше людей используют Интернет для выполнения повседневных транзакций, мы наращиваем наши усилия по защите потребителей от мошенников, стремящихся забрать с трудом заработанные деньги у потребителей, которым все более комфортно вести бизнес в киберпространстве», — сказал прокурор США Андре. Биротт-младший «Этот случай демонстрирует нашу способность выследить даже самых изощренных мошенников, которые пытались спрятаться за ложными именами и предполагаемой анонимностью Интернета.»

    В обвинительном заключении содержится ссылка на схему, по которой участники заговора предлагали автомобили, в том числе автомобили, мотоциклы, дома на колесах и лодки, для продажи на различных веб-сайтах. После того, как цена покупки была согласована по телефону и электронной почте, сообщники отправили по электронной почте мошеннические сообщения. Счета-фактуры покупателям. Фальшивые счета-фактуры, по-видимому, были получены с eBay, Edmunds.com, PayPal и Google Checkout, и в документах часто указывались названия и логотипы этих законных компаний.Жертвы были проинструктированы переводить согласованную цену покупки на банковские счета, которые, по их мнению, были связаны с эскроу-компаниями, но на самом деле они были созданы участниками заговора, которые часто использовали поддельные документы для открытия счетов. В фальшивых счетах ложно говорилось, что средства не будут переданы предполагаемым продавцам до тех пор, пока покупатели не получат и не утвердят приобретенные автомобили, а жертвам дополнительно сообщили, что у них есть возможность вернуть автомобили за счет продавца в течение недели с момента получения. и осмотр автомобиля.

    Несмотря на получение денежных средств от покупателя за автомобили, как утверждается в обвинительном заключении, ответчики не предоставили никаких транспортных средств потерпевшим.

    «К сожалению, бесчисленное количество потребителей ежегодно становятся жертвами изощренных схем интернет-мошенничества, и большинство из них никогда не вернут свои деньги», — сказал Клод Арнольд, специальный агент, отвечающий за расследование ICE Homeland Security Investigations в Лос-Анджелесе. «Хотя Служба национальной безопасности продолжит тесно сотрудничать со своими правоохранительными партнерами здесь и за рубежом, чтобы активно бороться с этим типом преступлений, интернет-покупатели также должны предпринять шаги, чтобы защитить себя.Прежде чем покупать что-либо в Интернете, покупатели должны убедиться, что их деньги поступают на законный счет, и всегда помнить: если цена звучит слишком хорошо, чтобы быть правдой, это, вероятно, так ».

    Согласно обвинительному заключению, Weikum контролировал мошеннический банк чтобы определить, депонировали ли жертвы средства. После того, как деньги были отправлены на поддельные банковские счета, деньги были сняты — в основном наличными — и деньги были доставлены Вейкуму и Мишине. Вейкум и Мишина якобы перевели деньги из Соединенных Штатов в другие страны, отправили средства в скрытых посылках в Берлин или спрятали средства в личной ручной клади во время поездки в Германию.

    Согласно обвинительному заключению, по меньшей мере 110 банковских счетов были открыты для получения доходов от мошенничества с продажей через Интернет. С 4 сентября 2007 года по 5 октября 2010 года жертвы депонировали не менее 4 миллионов долларов на мошеннические банковские счета.

    «Обвиняемые разработали схему с целью обмануть обычного интернет-покупателя», — сказал специальный агент IRS по уголовным расследованиям Лесли П. ДеМарко. «IRS продолжит использовать свои ресурсы для отслеживания денег, полученных от мошеннических схем в Интернете.Налоговое управление США беспокоит безопасность потребителей Интернета, и мы сделаем все от нас зависящее, чтобы бороться с этим современным мошенничеством ».

    Джозеф Бити, специальный агент, отвечающий за полевой офис Секретной службы США в Лос-Анджелесе, заявил:« Киберпреступность, включая это своего рода схема продаж через Интернет, претерпела значительные изменения за последние несколько лет. Сотрудничество между правоохранительными органами позволяет нам сосредоточить наши ресурсы и быстро реагировать на раскрытие и предотвращение преступной деятельности, такой как этот вид финансового мошенничества.»

    Каждое обвинение в мошенничестве, указанное в обвинительном заключении, влечет предусмотренное законом максимальное наказание в виде 30 лет лишения свободы. Каждое из обвинений в отмывании денег, указанное в обвинительном заключении, влечет за собой максимальное наказание в виде 20 лет лишения свободы.

    Вейкум и Мишина находятся в заключении. опекунство после предъявления обвинений в прошлом году в окружном суде США в Лас-Вегасе, штат Невада, Вейкум и Мишина ранее были обвинены в контрабанде крупных партий наличных, структурировании операций с наличными и фальшивых документах, удостоверяющих личность.В обвинительном заключении Невады, среди прочего, утверждается, что Вейкум пытался спрятать 1,1 миллиона долларов США в валюте в своем багаже ​​во время поездки в Германию в октябре 2009 года. Вейкум и Мишина должны предстать перед судом по делу Невады 24 января.

    Визуализация внутриклеточной перекиси водорода с помощью генетически кодируемого флуоресцентного зонда HyPer в клетках NIH-3T3

    @inbook {25e5b18f799b4d74a62a992c84acde41,

    title = «Визуализация внутриклеточного перекиси водорода с помощью генетически кодируемого флуоресцентного зонда 3000T NIH-30003 клеток HyP2 = «Активные формы кислорода (АФК) участвуют в регуляции нормальных физиологических функций клеток в качестве вторичных посредников, а также в неспецифическом повреждении биомолекул в патологическом процессе, известном как окислительный стресс.Семейство генетически кодируемых зондов HyPer — полезный неинвазивный инструмент для мониторинга динамики АФК в реальном времени в отдельных клетках или модельных организмах. HyPer, первый генетически закодированный зонд для обнаружения перекиси водорода (h3O2), окисляется с высокой специфичностью и чувствительностью с помощью h3O2, что приводит к ратиометрическим изменениям в спектре возбуждения флуоресценции зонда. Эти изменения могут быть обнаружены с помощью широкого спектра коммерческих систем конфокальных и широкопольных микроскопов. Здесь мы описываем подробный протокол для ратиометрического мониторинга h3O2, продуцируемого D-аминокислотной оксидазой (DAAO) или NADPH-оксидазой (NOX) в клетках NIH-3T3 с использованием зонда HyPer.»,

    keywords =» Оксидаза D-аминокислоты, DAAO, HyPer, HyPerRed, перекись водорода, микроскопия, PDGF, ROS, ратиометрическая визуализация «,

    author =» Ермакова, {Юлия Г.} и Мишина, {Наталия М. .} и Карстен Шульц и Белоусов, {Всеволод В.} «,

    note =» Информация о финансировании: Работа поддержана грантом Российского научного фонда 17-14-01086 (эксперименты с оксидазой D-аминокислот), Российский фонд для гранта фундаментальных исследований 18-54-74003 (обработка изображений и эксперименты с PDGF) и DFG IRTG 1816.ЕГЭ получила стипендию Сергея Шпиза. Частично эксперименты проводились на оборудовании ИБХК (ЦКП ИБХН, грант Минобрнауки РФ RFMEFI62117X0018). Авторские права издателя: {\ textcopyright} Springer Science + Business Media, LLC, часть Springer Nature 2019. «,

    год =» 2019 «,

    doi =» 10.1007 / 978-1-4939-9424-3_15 «,

    language = «Английский (США)»,

    series = «Методы молекулярной биологии»,

    publisher = «Humana Press Inc.»,

    pages =» 259—274 «,

    booktitle =» Методы молекулярной биологии «,

    }

    Тендер Правительства Российской Федерации по проведению открытого аукциона в электронной форме на право владения …

    На главную > Тендеры> Европа> Россия> Открытый аукцион в электронной форме на право заключения договора

    ПУБЛИЧНОЕ АКЦИОНЕРНОЕ ОБЩЕСТВО «РОСТЕЛЕКОМ» объявило тендер на проведение открытого аукциона в электронной форме на право заключения договора на поставку новогодних подарков детям сотрудников макрорегионального филиала ПАО «Центр» «Ростелеком».Месторасположение проекта — Россия, тендер закрывается 30 августа 2021 года. Номер тендерного объявления — 32110552043, а ссылочный номер TOT — 195. Претенденты могут получить дополнительную информацию о тендере и могут запросить полную тендерную документацию, зарегистрировавшись на сайте.

    Страна: Россия

    Резюме: Открытый аукцион в электронной форме на право заключения договора на поставку новогодних подарков детям сотрудников макрорегионального филиала ПАО «Центр»

    Срок: 30 августа 2021 г.

    Реквизиты покупателя

    Покупатель: ОБЩЕСТВЕННОЕ АКЦИОНЕРНОЕ ОБЩЕСТВО «РОСТЕЛЕКОМ»
    1

  • , г.Санкт-Петербург, наб. Синная, д. 14, корпус Литл А
    ФИО: — Мишина Ю.Г.
    Контактный телефон: — +7 (915) 4801340
    Россия
    Электронная почта: [email protected]

    Прочая информация

    ТОТ Ссылка: 195

    Номер документа. №: 32110552043

    Конкурс: ICB

    Финансист: Самофинансируемый

    Информация о тендере

    Наименование лота: — Доставка новогодних подарков детям сотрудников Макрорегионального филиала «Центр ПАО« Ростелеком »
    Услуги по оптовой торговле шоколадом и сахарными кондитерскими изделиями

    Дополнительные документы

    Нет дополнительных документов..!

    Какая антиоксидантная система формирует внутриклеточные градиенты h3O2?

    Реферат

    Клеточные антиоксидантные системы контролируют уровень перекиси водорода (H 2 O 2 ) в клетках. Существует множество теоретических моделей, которые предсказывают диффузионные свойства H 2 O 2 в зависимости от скорости образования H 2 O 2 , количества и скорости реакции компонентов антиоксидантного оборудования.Несмотря на эти теоретические предсказания, остается неизвестным, как антиоксидантные системы формируют внутриклеточные градиенты H 2 O 2 . Относительная роль систем тиоредоксина (Trx) и глутатиона в формировании и поддержании паттерна H 2 O 2 является еще одним спорным вопросом. Здесь мы визуализировали клеточную антиоксидантную активность и образование градиентов H 2 O 2 , используя хемогенетические подходы для создания разделенных внутриклеточных H 2 O 2 и используя биосенсор H 2 O 2 HyPer для анализа в результате H 2 O 2 распределение в определенных субклеточных компартментах.Используя клетки человека HeLa в качестве модельной системы, мы предполагаем, что система Trx, но не система глутатиона, регулирует внутриклеточные градиенты H 2 O 2 . Антиоксид. Редокс-сигнал. 31, 664–670.

    Ключевые слова: H 2 O 2 градиенты, хемогенетика, тиоредоксинредуктаза, HyPer, оксидаза D-аминокислот

    Введение

    Аэробные организмы используют кислород не только как конечный акцептор электронов в дыхательной цепи, но и в качестве источника активных форм кислорода (АФК), таких как супероксид-анион, пероксид водорода (H 2 O 2 ) и гидроксильный радикал (7).Стабильная ROS H 2 O 2 представляет собой молекулу с хорошо известными сигнальными ролями, действующую в основном через окисление специфических тиолов. H 2 O 2 локально продуцируется в клетках различными ферментными системами, включая, помимо прочего, НАДФН-оксидазы и компоненты дыхательной цепи митохондрий. Пространственное и временное распределение H 2 O 2 внутри клеток должно контролироваться конкурирующими действиями и дифференциальным распределением окислительного и антиоксидантного ферментативного механизма, но это еще мало изучено.Избыточное производство окислителя или недостаточное поглощение окислителя приводит к окислительному стрессу, состоянию, связанному со многими патологическими состояниями (7).

    Инновации

    Основная проблема при использовании методов визуализации для изучения внутриклеточного пероксида водорода (H 2 O 2 ) заключается в том, что эндогенный H 2 O 2 , его источники и поглотители по-разному присутствуют в разных местах . Если визуализировать какое-то конкретное распределение H 2 O 2 , неясно, как оно формируется активностью H 2 O 2 , синтезирующих и поглощающих ферменты.Мы использовали хемогенетический подход для введения генератора H 2 O 2 в четко определенное субклеточное местоположение и визуализировали полученное распределение H 2 O 2 с помощью целевых биосенсоров HyPer. Это позволило нам визуализировать и проанализировать активность поглощения пероксида и определить распределение H 2 O 2 в живых клетках.

    Две основные клеточные системы метаболизма H 2 O 2 связаны с тиоредоксином (Trx) и глутатионом (7).Обе системы полагаются на НАДФН как на источник электронов для восстановления H 2 O 2 через цепочку событий обмена тиола или селенола. Система глутатиона передает восстанавливающие эквиваленты от НАДФН к глутатиону через глутатионредуктазу , поддерживая миллимолярный цитоплазматический пул восстановленного глутатиона (GSH), который можно использовать для восстановления H 2 O 2 с помощью селенопротеин глутатионпероксидазы (GPX) . Система Trx перемещает восстанавливающие эквиваленты до H 2 O 2 от NADPH через тиоредоксинредуктазу (TrxR) к Trxs, что, наконец, эффективно поддерживает восстановление H 2 O 2 под действием Trx-зависимых пероксиредоксинов ( Prxs).Тиолпероксидазы из семейства Prx обычно считаются основными поглотителями H 2 O 2 в цитозоле и митохондриях. Однако в большинстве случаев относительный вклад систем Trx и глутатиона в секвестрацию H 2 O 2 остается неизвестным.

    Теоретическое моделирование предсказывает, что расстояние диффузии H 2 O 2 в цитозоле ограничено несколькими микрометрами (9) из-за очень высокой концентрации и скорости реакции внутриклеточных пероксидаз.Исследования с использованием генетически закодированных сенсоров предполагают еще меньшее расстояние диффузии (6). Однако были лишь ограниченные попытки визуализировать деятельность клеточного антиоксидантного механизма. Например, биосенсор Trx-RFP позволяет отслеживать активность Trx (4), но интерпретация результатов с использованием Trx-RFP затруднена тем фактом, что Trx сам является источником электронов для ферментов Prx и не играет прямой роли в H 2. O 2 деградация. Другая проблема при визуализации активности по улавливанию H 2 O 2 заключается в том, что ферментные источники поколения H 2 O 2 динамически нацелены на определенные субклеточные домены, так что точное местоположение внутриклеточного H 2 O 2 источник не может быть определен.Наблюдаемый паттерн распределения H 2 O 2 в клетке может быть результатом интерференции между неизвестным паттерном производства окислителя и другим неизвестным паттерном антиоксидантной активности. Следовательно, H 2 O 2 следует предпочтительно контролировать в хорошо контролируемых условиях, если нужно понимать градиенты H 2 O 2 .

    Мы рационализировали эту разработку клеточной системы, в которой хемогенетический генератор H 2 O 2 имеет точное известное местоположение внутри клетки в сочетании с детектором для H 2 O 2 , привязанным к сети относительно неподвижные субклеточные структуры могли бы помочь визуализировать, как антиоксидантная активность формирует паттерны метаболизма H 2 O 2 внутри клетки.

    Результаты, обсуждение и будущие направления

    Для создания H 2 O 2 мы нацелили дрожжевую оксидазу d-аминокислот (DAO) на ядро ​​клетки путем слияния DAO с сигналом локализации ядра (NLS) () . DAO остается неактивным в отсутствие его субстратов D-аминокислот, но когда он снабжен D-аланином (D-Ala), DAO генерирует субмикромолярные количества H 2 O 2 (5). Нацеливание DAO на ядро ​​гарантирует, что после добавления D-Ala в ядре будет продуцироваться H 2 O 2 , создавая четко определенный пространственно-временной паттерн поколения H 2 O 2 .

    Chemogenetic H 2 O 2 градиент, визуализируемый направленным на митохондрии HyPer-3. (A) Схема системы генерации / детекции H 2 O 2 , в которой конструкция DAO-NLS генерирует H 2 O 2 в ядре только при условии ее субстрата D-Ala. Биосенсор H 2 O 2 HyPerRed-NLS нацелен на ядро ​​клетки для мониторинга локальной продукции H 2 O 2 DAO с ядерной мишенью, тогда как митохондриальный mito-HyPer-3 обнаруживает распространение из H 2 O 2 от ядра к цитоплазме / митохондриям. (B) Типичные изображения клеток, отображаемые в трех флуоресцентных каналах: два для HyPer-3 и один для HyPerRed. Масштабная линейка = 10 мкм. (C) В верхнем ряду показаны ратиометрические изображения тех же клеток из панели (B) , проанализированные после добавления D-Ala. После добавления D-Ala поколение H 2 O 2 в ядре отслеживается с помощью HyPerRed-NLS ( нижний ряд ). H 2 O 2 при выходе из ядра образует градиент, видимый при использовании mito-HyPer-3.Для количественной оценки выбираются две области интереса, как показано. ROI1 выбирается на периферии ядра, а ROI2 — в области, удаленной от ядра. (D) Время изменения H 2 O 2 в пределах ROI1, ROI2 и в ядре клетки, показанной на панели (C) . Эти результаты показывают, что мито-HyPer-3 в ROI1 становится почти полностью окисленным H 2 O 2 , выходящим из ядра, тогда как в ROI2 HyPer-3 остается восстановленным.D-Ala, D-аланин; DAO, оксидаза d-аминокислот; H 2 O 2 , перекись водорода; NLS — сигнал локализации ядра; ROI, регионы интересов. Цветные изображения доступны в Интернете.

    Для визуализации высвобождения H 2 O 2 из ядра мы использовали HyPer-3, ратиометрический генетически кодируемый зонд (2). При использовании в нелокализованной версии HyPer-3 свободно диффундирует в нуклеоцитозольном компартменте, что делает невозможным визуализацию градиентов H 2 O 2 внутри любого конкретного субклеточного компартмента.Однако биосенсор HyPer может быть нацелен на определенные субклеточные органеллы, что позволяет анализировать H 2 O 2 , исходящий из отдельного источника H 2 O 2 (6). Мы использовали здесь зонд, нацеленный на митохондриальный матрикс, потому что митохондрии образуют стабильную сеть внутри клетки и сохраняют свое положение в клетке на протяжении всего эксперимента. Локализованная в ядре DAO как хемогенетический генератор H 2 O 2 вместе с датчиком mito-HyPer-3 позволяет нам ответить на несколько ключевых вопросов: Будет ли H 2 O 2 , произведенный DAO-NLS сможет выйти из ядра? Если да, то как далеко он распространился бы? Какая ветвь клеточной антиоксидантной системы может регулировать распределение H 2 O 2 внутри клеток?

    Чтобы ответить на эти вопросы, мы трансфицировали клетки HeLa-Kyoto плазмидами, кодирующими DAO-NLS, вместе с биосенсорами, нацеленными на ядро ​​HyPerRed-NLS (3), и митохондриями mito-HyPer-3 ().HyPerRed-NLS служит для мониторинга продукции H 2 O 2 в ядре, а mito-HyPer-3 позволяет визуализировать пространственно-временное распределение H 2 O 2 в митохондриях вне ядра. Добавление 4 мкл M D-Ala к клеткам приводило к продукции H 2 O 2 в ядре, что измерялось как усиление сигнала HyPerRed-NLS. Поскольку окисление HyPerRed в этих условиях обычно является неполным, мы предполагаем, что активность DAO приводит к <200 n M H 2 O 2 в ядре.После образования в ядре H 2 O 2 сразу же появился в цитоплазме и начал окислять HyPer-3 в митохондриях, окружающих ядро, но не в отдаленных периферических митохондриях (; Дополнительное видео S1). Добавление избытка экзогенного H 2 O 2 привело к равному и полному окислению мито-HyPer-3 в перинуклеарных и удаленных митохондриях.

    Визуализация сконструированного градиента H 2 O 2 с помощью зонда HyPer-3, нацеленного на митохондриальный матрикс, не исключает возможности прямого переноса H 2 O 2 между ядром и митохондриальным матриксом без прохождения цитозоля, хотя механистическая основа такого предполагаемого транспорта неизвестна.Поэтому мы стремились найти способ визуализировать градиент H 2 O 2 также в цитозоле. С этой целью мы создали гибридный белок между HyPer и кератином, промежуточную нить, которая образует относительно стабильную сеть внутри цитозоля. Связывание HyPer с кератином предотвращает быструю диффузию биосенсора в цитозольном компартменте. Добавление D-Ala к клеткам, экспрессирующим кератин-HyPer и DAO-NLS, привело к быстрому образованию градиента H 2 O 2 в цитозоле, который имел форму, аналогичную той, которая была визуализирована с использованием митохондриального HyPer3. ().HyPer, связанный с перинуклеарными филаментами, демонстрировал шаровидную картину окисления, тогда как зонд на периферических филаментах не окислялся. Эти эксперименты показывают, что градиент H 2 O 2 , сформированный DAO-NLS, существует как в цитозоле, так и в митохондриях, с более высокими уровнями вблизи ядра.

    Определение хемогенетического градиента H 2 O 2 в цитозоле. (A) Флуоресцентные изображения репрезентативных клеток HeLa-Kyoto, экспрессирующих DAO-NLS с ядерной мишенью и HyPer-keratin, нацеленный на цитозоль, демонстрирующие стабильную сеть слитого белка биосенсора H 2 O 2 в цитозоле.ROI1 находится в перинуклеарной области, а ROI2 — на периферии клетки, как показано красными прямоугольниками на этом изображении. (B) Динамика количественной оценки вызванных D-Ala изменений в соотношении HyPer в ROI1 и ROI2. (C) Ратиометрические изображения клеток, показанные на панели (A) до и после добавления D-Ala, а также после насыщения экзогенным H 2 O 2 . Масштабные линейки = 10 мкм. Цветные изображения доступны в Интернете.

    У клетки есть несколько возможностей предотвратить широкую внутриклеточную диффузию H 2 O 2 .Каталаза пероксисом, глутатион, связанный с GPX, и Prxs, подпитываемые путем Trx, — все они могут играть ключевые роли в качестве привратников H 2 O 2 .

    Чтобы изучить эти различные возможности, мы использовали ряд ингибиторов, которые затем оценили, используя простую стратегию количественной оценки. Формирование градиента H 2 O 2 приводит к более высокому сигналу HyPer-3 в митохондриях, окружающих ядро, по сравнению с периферическими зонами. Следовательно, этот градиент можно проанализировать как профиль соотношения HyPer-3 вдоль линии, проведенной через ячейку (красные линии).Изменения этого профиля со временем, связанные с образованием или рассеянием градиента H 2 O 2 , можно визуализировать как кимограф, где одно измерение представляет собой профиль отношения HyPer-3 вдоль линии, а второе измерение — время: каждый профиль следующей строки, снятый в t + 1 изображение отрисовывается под предыдущим из кадра t (). Затем первая представляющая интерес область (ROI1) выбирается как область кимографа, представляющая перинуклеарные митохондрии после добавления D-Ala, и ROI2 ассоциируется с периферическими митохондриями в тот же период времени.Если градиента не существует, соотношение ROI1 / ROI2 становится равным или близким к 1, что отражает отсутствие разницы в соотношении HyPer-3 между перинуклеарными и удаленными митохондриями. Чем выше межклеточное соотношение H 2 O 2 , тем круче будет внутриклеточный градиент H 2 O 2 .

    Внутриклеточный градиент H 2 O 2 поддерживается тиоредоксиновой системой. (A) Ратиометрические изображения мито-HyPer-3 в клетках, экспрессирующих DAO-NLS. Верхний ряд : контрольные клетки образуют стабильный градиент H 2 O 2 в цитоплазме после добавления D-Ala. Нижний ряд : предварительная инкубация клеток с ауранофином приводит к равномерному базальному окислению mito-HyPer-3 по всей клетке, которое становится еще более экстремальным при добавлении либо D-Ala, либо экзогенного H 2 O 2 . Масштабная линейка = 10 мкм. (B) Влияние различных ингибиторов окислительно-восстановительного потенциала на градиент H 2 O 2 .Градиент определяли количественно как отношение сигнала мито-HyPer-3, измеренного в перинуклеарной области, к соотношению, наблюдаемому в митохондриях, расположенных на расстоянии от ядра. Отношение 1 (показано синей линией ) указывает на отсутствие градиента. Чем выше коэффициент, тем круче градиент H 2 O 2 . Столбцы показывают среднее значение ± стандартное отклонение не менее 10 измерений в каждой из 3 биологических повторностей. * p <0,001, ** p <0.05 по двусторонней неравной дисперсии т -тест. (C) Типичные временные проекции (кимограммы) градиентов H 2 O 2 вдоль линий, выделенных красным цветом на панели (A) в контрольных и предварительно обработанных ауранофином клетках. Цифры «1» и «2» обозначают ROI1 и ROI2 соответственно; эти две области интереса были проанализированы для количественной оценки результатов для панели (B) . SD, стандартное отклонение. Цветные изображения доступны в Интернете.

    При анализе кимографов мы обнаружили, что добавление D-Ala приводит к значительному соотношению ROI1 / ROI2> 1, что отражает формирование градиента H 2 O 2 (, контрольная полоса).Инкубация клеток с ингибитором каталазы 3-AT не приводила к изменениям интенсивности градиента, что позволяет предположить, что каталаза не участвует в образовании градиента. В отличие от этого, предварительная инкубация клеток с ауранофином, мощным ингибитором TrxR (дополнительный рисунок S1A), привела к полному устранению градиента (дополнительное видео S2). В этом случае добавление D-Ala привело к быстрому окислению HyPer3 как в перинуклеарных, так и в периферических митохондриях. Более того, контрольное добавление внеклеточного H 2 O 2 в конце серии изображений не смогло дополнительно окислить HyPer3, что указывает на то, что индикатор достиг насыщения.Это указывает на то, что ветвь Trx внутриклеточной антиоксидантной системы формирует градиент H 2 O 2 , предотвращая диффузию H 2 O 2 , вероятно, посредством Prxs. Следует отметить, что до добавления D-Ala зонд HyPer-3, по-видимому, был в основном восстановлен, что указывает на то, что отсутствие градиента H 2 O 2 не было результатом ранее существовавшего окисления HyPer-3. вызвано самим лечением ауранофином.

    Также система глутатиона участвует в метаболизме H 2 O 2 через действия селенопротеина GPX, которые восстанавливают H 2 O 2 до H 2 O за счет окисления глутатиона.Таким образом, мы предположили, что подавление системы глутатиона также приведет к ослаблению градиента H 2 O 2 . К нашему удивлению, обработка клеток l-бутионин-сульфоксимином (BSO), мощным ингибитором синтеза глутатиона (дополнительный рис. S1B), не только не разрушила градиент, но, фактически, сделала его еще сильнее () . Одним из возможных объяснений этого наблюдения может быть то, что ингибирование синтеза GSH ведет к компенсаторной активации системы Trx.Альтернативным объяснением может быть то, что NADPH, обычно используемый для поддержания высокого отношения восстановленного глутатиона к окисленному (GSH / GSSG), становится доступным для TrxR, повышая доступность восстанавливающих эквивалентов для клеточных Prxs.

    Ауранофин является мощным ингибитором как цитозольного TrxR1, так и митохондриального TrxR2 (8). Таким образом, возможно, что обе эти изоформы TrxR могут вносить вклад в поддержание градиентов H 2 O 2 в цитоплазме. Альтернативно, только цитозольный TrxR1 может быть основным источником восстанавливающих эквивалентов для очистки H 2 O 2 .Чтобы проверить эти две возможности, мы затем использовали недавно разработанный ингибитор Trx, TRi-1, который предпочтительно ингибирует цитозольный TrxR1 по сравнению с митохондриальным TrxR2 в концентрации 1 μ M , используемой в нашем исследовании (8). Приведет ли добавление TRi-1 к той же потере паттерна H 2 O 2 , которую мы наблюдали с ауранофином? Предварительная инкубация клеток с TRi-1 действительно приводила к разрушению градиента H 2 O 2 , хотя и не так полно, как в случае эквимолярных концентраций ауранофина ().Это может указывать на то, что цитоплазматические градиенты H 2 O 2 поддерживаются согласованным действием как TrxR1, так и TrxR2, хотя здесь может быть подтверждена только важность TrxR1 для этого с частичным ингибированием H 2 O 2 с использованием обработки ингибитором TrxR1 TRi-1.

    Таким образом, здесь мы проанализировали сконструированные градиенты H 2 O 2 , которые хемогенетически продуцируются специфическими внутриклеточными контролируемыми субстратами источниками, нацеленными на ядро ​​клетки (DAO-NLS).H 2 O 2 , продуцируемый в ядре, образует градиент по цитоплазме. В этих клетках система Trx оказалась центральной детерминантой, устанавливающей градиент H 2 O 2 и предотвращающей широкую диффузию H 2 O 2 в цитоплазме. Ни каталаза, ни глутатион, по-видимому, не играют важной роли в формировании градиента H 2 O 2 . Остается определить, играют ли питаемые Trx ферменты аналогичную роль в других типах клеток, чем клетки HeLa, используемые здесь.Возможно, что некоторые типы клеток могут использовать GSH в качестве источника электронов для пространственно-временного контроля H 2 O 2 , но это требует экспериментального рассмотрения в будущих исследованиях. Однако известно, что многие раковые клетки полагаются на систему Trx больше, чем нормальные клетки (1), и, как показано здесь, типичные раковые клетки HeLa также используют путь Trx, чтобы способствовать образованию внутриклеточного H 2 O 2 градиенты. Мы считаем, что комбинация хемогенетических подходов с использованием дифференциально нацеленной DAO с конструкциями HyPer, как показано здесь, облегчит анализ внутриклеточного метаболизма H 2 O 2 в различных экспериментальных системах и в болезненных состояниях.

    Материалы

    H 2 O 2 , D-Ala, D-глюкоза, соли Тирода, BSO, 3-амино-1,2,4-триазол (3-AT) и ауранофин были приобретены у Sigma . TRi-1 был разработан и синтезирован, как описано в другом месте (8). Среда Игла, модифицированная Дульбекко (DMEM), минимальная необходимая среда Opti, фетальная телячья сыворотка (FCS), пенициллин-стрептомицин и эндонуклеазы рестрикции FastDigest были получены от ThermoFisher Scientific. Набор для полимеразной цепной реакции (ПЦР) и набор для быстрого лигирования были от Evrogen.4- (2-Гидроксиэтил) -1-пиперазинэтансульфоновая кислота (HEPES) и реагент для трансфекции FuGeneHD были от Promega. Посуда со стеклянным дном была от WPI. Клеточная линия HeLa-Kyoto была предоставлена ​​Carsten Schultz, EMBL.

    ДНК-конструкции

    Конструкцию pCAGGS-HyPer-keratin получали путем клонирования с помощью ПЦР с перекрывающимся удлинением. HyPer амплифицировали из PC1-HyPer (Evrogen) с праймерами 5′-GCAACGCCTCTGACGGTGGTGGGTCTGGTGGTATGGAGATGGCGAGCCAGC-3 ‘и 5′-AATTTCTAGATTAAACCGCCTGTTTTAAAACTTTATCGAAATGGC-3′ и кератин амплифицировал из pTagRFP-кератина (Evrogen) с праймерами 5’-AATTGAATTCGCCACCATGAGCTTCACCACTCGCTCCA-3 ‘и 5’ -CCACCGTCAGAGGCGTTGCCCCCAGTTCCGGAATGCCTCAGAACTTTGGTGTCATTGGT-3 ‘.Слитый продукт ПЦР расщепляли Eco RI и Xba I и лигировали в pCAGGS-Raichu-RhoA-CR (Addgene 40258).

    Для генерации PC1-DAO-NLS, ДАО-NLS амплифицировали из PCMV-DAO (2) с праймерами 5′-ACCGCTAGCGCCACCATGCAATTGCACAGCCAGAAGAGG-3 ‘и 5′-ACCAAGCTTTTACTACCTTTCTCTTCTTTTTTGGATCTACCTTTCTCTTCTTTTTTGGATCTACCTTTCTCTTCTTTTTTGGATCGCTCTCCCTAGCTGCGC-3’. Продукт ПЦР расщепляли Nhe I и Hin dIII и лигировали в предварительно расщепленный pHyPer-nuc (Evrogen) с удаленной кодирующей областью HyPer.

    Для создания pC1-HyPerRed-NLS, HyPerRed был амплифицирован из pC1-HyPer-Red (Addgene 48249) с праймерами 5′-AATTGCTAGCGCCACCATGGAGATGGCGAGCCAGC-3 ‘и 5’TAGATAGATCTGAGTCCGTCCA 3’-AATTAGATCTGAGTCCG. Продукт ПЦР расщепляли Nhe I и Bgl II и лигировали с предварительно расщепленным pHyPer-nuc (Evrogen).

    Для создания pLCMV-HyPer3-mito, HyPer3 был амплифицирован из pC1-HyPer3 (Addgene 42131) с использованием праймеров 5′-ATCTGGATCCACCGGTCGCCACCGAGATGGCGAGCCAGCA-3 ‘и 5TTTA’-CGCAGTCGACTTTAAC.Продукт ПЦР расщепляли Bam HI и Sal I. Дублированную митохондриальную нацеливающую последовательность (dMito) вырезали из вектора pHyPer-dMito (Евроген) с помощью Nhe I и Bam HI. Продукты рестрикции HyPer3 и dMito лигировали в вектор pLCMV-Puro, расщепленный Nhe I и Sal I.

    Все конструкции подтверждали анализом полной последовательности.

    Культивирование клеток и трансфекция

    Клетки HeLa-Kyoto культивировали в среде DMEM с добавлением 100 Ед / мл пенициллина, 100 мкг / мл стрептомицина, 2 м M l-глутамин и 10% FCS при 37 ° C в атмосфере, содержащей 95% воздуха и 5% CO 2 .Клетки разделяли через день и высевали на чашки со стеклянным дном. Через 24 часа клетки трансфицировали смесью векторной ДНК и реагента для трансфекции FuGeneHD в соответствии с рекомендациями производителя.

    Визуализация

    Через сорок восемь часов после трансфекции культуральную среду заменили на 1,8 мл предварительно нагретого солевого раствора Тирода с добавлением 20 м M HEPES и дополнительных 20 м глюкозы M и изображение было получено с помощью широкоугольного микроскопа Leica 6000, оснащенного HCX PL. АПО фунт.Масляный объектив BL 63 × 1.4NA и термостат. Флуоресценцию зонда HyPer возбуждали последовательно через полосовые фильтры возбуждения , 427/10 и 504/12. Эмиссия собиралась каждые 10 или 15 с с использованием полосового эмиссионного фильтра 525/50. Для зонда HyPerRed использовался фильтрующий куб TX2 (возбуждение: BP 560/40, дихроматическое зеркало 595, излучение: BP 645/75). После получения 10–12 изображений добавляли 200 мкл Tyrode с D-Ala до конечной концентрации 5–8 м M . Сто пятьдесят микромоляров H 2 O 2 добавляли в конце каждого эксперимента для максимального окисления HyPer.

    Обработка ингибитором

    BSO и 3-AT растворяли в mQ при исходных концентрациях 100 мкМ M и 1 M, соответственно и хранили замороженными при -20 ° C. Клетки предварительно инкубировали с 0,5 мкм M BSO в течение 22 часов и 10 мкм M 3-AT в течение 2 часов перед визуализацией.

    Ауранофин растворяли в диметилсульфоксиде (ДМСО) при исходной концентрации 14,3 м M и хранили при 4 ° C. Ауранофин и TRi-1 добавляли к клеткам в концентрации 1 мкМ M и инкубировали в течение 1 ч перед визуализацией.

    Измерение активности TrxR и содержания GSH в клетках, обработанных ингибиторами

    Для измерения активности TrxR мы использовали набор для анализа тиоредоксинредуктазы (ab83463; Abcam). В этом анализе TrxR катализирует НАДФН-зависимое восстановление 5,5′-дитиобис (2-нитробензойной) кислоты (DTNB) до 5-тио-2-нитробензойной кислоты (TNB 2-), которое дает ярко-желтый цвет ( λ max = 412 нм). Ингибиторы ауранофин и Tri-1 добавляли к клеткам HeLa-Kyoto в концентрациях 1 и 10 мкМ M , после чего клетки инкубировали в течение 1 часа.Клетки, обработанные таким же объемом ДМСО (5 мкл), использовали в качестве контроля. Для пробоподготовки использовали 2 × 10 6 ячеек. Все измерения проводились в прозрачных 96-луночных планшетах с плоским дном (Corning) на планшет-ридере Tecan Infinite 200 Pro в соответствии с протоколом производителя (Abcam). Кинетические кривые измеряли при OD 412 нм в течение 100 мин.

    Для измерения общего глутатиона мы использовали набор для определения соотношения GSH / GSSG II (ab205811; Abcam). В этом наборе используется запатентованный нефлуоресцентный краситель, который становится сильно флуоресцентным при непосредственной реакции с GSH.Для анализа клетки HeLa-Kyoto инкубировали с 0,5 мкл M BSO в течение 22 часов. Необработанные клетки использовали в качестве контроля. Для пробоподготовки использовали 3 × 10 6 ячеек. Все измерения проводились в соответствии с протоколом производителя. Мы контролировали флуоресценцию при Ex / Em = 490/520 нм на планшет-ридере Tecan Infinite 200 Pro, используя черные 96-луночные планшеты с плоским дном (Greiner Bio-One).

    Концентрацию белка для обоих протоколов определяли с использованием набора для анализа белков бицинхониновой кислоты (BCA1 AND B9643; Sigma Aldrich).

    Обработка временных рядов

    Временные ряды анализировались с использованием бесплатного программного обеспечения Fiji ImageJ. Фон вычитался из стопок от 420 до 500 нм (соответствует двум пикам возбуждения HyPer). Изображения были преобразованы в 32-битные, а для стека 420 нм был установлен порог для удаления значений пикселей из фона (функция Not-a-Number). Стек 500 нм был разделен на стек 420 нм кадр за кадром. Полученный стек был изображен в псевдоцветах с использованием таблицы поиска «16 цветов». Динамика флуоресценции HyPer была рассчитана для ROI внутри отображаемой клетки.Для и, две области интереса были созданы для каждой клетки, соответствующей перинуклеарной области (ROI1) и дистальной области (ROI2—12-16 мкм от ядра).

    For, кимографы были сгенерированы из стека изображений HyPerRed-NLS (ядро) и стека изображений с соотношением HyPer3-митохондрии (митохондрии) путем усреднения по областям интереса шириной 9 пикселей (, например, , обозначено красными линиями, показанными на). Используя кимограф HyPerRed-NLS, для кимографа HyPer3-митокимографа был установлен порог для удаления значений пикселей из ядерной области (функция Not-a-Number), чтобы получить результирующий кимограф для каждой клетки ( e.грамм. ,). Для каждого результирующего кимографа устанавливали две области интереса, соответствующие перинуклеарной области (ROI1) и дистальной области (ROI2—13 мкм от области ROI1), и рассчитывали значение ROI1 / ROI2.

    Анастасия Мишина Александр Галлямов «⛸ FS Gossips

    Тамара Москвина: «Программа Мишиной и Галлямова — это посвящение молодежи мира. Все начинается с романтики, а потом строят жизнь, семью, профессию, летают в космос »

    Размещено 13.10.2021 • Пока комментариев нет

    Тамара Москвина о произвольной программе Мишиной и Галлямова и критике, с которой они столкнулись.Просмотреть этот пост на […]

    Обзор Instagram: лучшие фото недели [03.09-17.09.2021]

    Опубликовано 2021-09-17 • 2 комментария

    «На льду» Пайпер Жиль и Поль Пуарье Посмотреть этот пост в Instagram Пост, опубликованный пользователем […]

    Тамара Москвина: «Имеет значение только конечный результат. Вовремя показать — главная цель нашей работы »

    Размещено 15.09.2021 • Пока комментариев нет

    Интервью с Тамарой Москвиной. О важности серии Гран-при перед Олимпиадой, возможности […]

    Обзор Instagram: лучшие фото недели [06.08-13.08.2021]

    Размещено 13.08.2021 • Пока комментариев нет

    «На льду» Михаил Коляда, Флоран Амодио, Елизавета Туктамышева, Софья Самодурова и Андрей Лазукин […]

    Обзор Instagram: лучшие фото недели [02.07-09.07.2021]

    Размещено 09.07.2021 • Пока комментариев нет

    «На льду» Евгения Медведева и Александр Энберт Посмотреть этот пост в Instagram Пост […]

    Тамара Москвина о новых программах для пар

    Размещено 29.06.2021 • Пока комментариев нет

    Тамара Москвина рассказала о новых программах для фигуристов своей группы.источник: видеоинтервью matchtv.ru, текст […]

    Обзор Instagram: лучшие фото недели [11.06-18.06.2021]

    Размещено 20.06.2021 • Пока комментариев нет

    «На льду» Алексей Мишин и Луна Хендрикс Посмотреть этот пост в Instagram Опубликован пост […]

    Обзор Instagram: лучшие фото недели [28.05-04.06.2021]

    Опубликовано 2021-06-04 • 1 комментарий

    «На льду» Кирстен Мур-Тауэрс, Майкл Маринаро, Марк Пиллэй и Элисон Пуркисс Просмотреть этот пост […]

    Артур Минчук — про шутки Москвиной, «конфликты» фигуристов и Пекин-2022

    Размещено 01.06.2021 • Пока комментариев нет

    Интервью с Артуром Минчуком.О работе с Тамарой Москвиной, Мишиной-Галлямовым, Бойковой-Козловским и планах на […]

    Обзор Instagram: лучшие фото недели [21.05-28.05.2021]

    Опубликовано 28.05.2021 • Пока комментариев нет

    «На льду» Лаура Баркеро и Марко Зандрон Посмотреть этот пост в Instagram Опубликован пост […]

    Обзор Instagram: лучшие фото недели [26.03-02.04.2021]

    Опубликовано 2021-04-06 • 3 комментария

    «На льду» Брэди Теннелл Лайла Страх и Льюис Гибсон Тиффани Загорски и Джонатан […]

    Анастасия Мишина и Александр Галлямов: «Мы созданы друг для друга»

    Опубликовано 16.03.2021 • Пока комментариев нет

    Интервью Анастасии Мишиной — Александр Галлямов.Об их паре, причинах перехода на Москвину и […]

    Обзор Instagram: лучшие фото недели [11.12-18.12.2020]

    Опубликовано 20.12.2020 • 2 комментария

    «На льду» Евгений Плющенко, Юлия Липницкая и Елена Ильиных Конрад Орзель Кирстен […]

    Мишина и Галлямов: «Тамара Москвина не позволит проявить неуважение к кому-либо, будь то тренер или спортсмен».

    Опубликовано 16.12.2020 • Пока комментариев нет

    Интервью с Анастасией Мишиной и Александром Галлямовым. О причинах смены тренера, отношениях с […]

    Тамара Москвина: «Чем сильнее конкуренция в группе, тем лучше для тренера».

Добавить комментарий

Ваш адрес email не будет опубликован.